5Июн

Шер шах: ШЕР-ШАХ • Большая российская энциклопедия

Содержание

ШЕР-ШАХ • Большая российская энциклопедия

  • В книжной версии

    Том 35. Москва, 2017, стр. 15

  • Скопировать библиографическую ссылку:


Авторы: И. Ю. Котин

ШЕР-ШАХ (1486, Са­са­рам, Би­хар – 22.5.1545, Ка­ланд­жар), инд. пра­ви­тель афг. (пуш­тун­ско­го) про­ис­хо­ж­де­ния. Трон­ное имя – Фа­рид ад-дин Шер-шах Су­ри ибн Ха­сан Хан. Ро­дом из пле­ме­ни Сур. Сын афг. вои­на, на­чал служ­бу как ну­кер (во­ин-на­ём­ник) в ар­мии пра­ви­те­ля Би­ха­ра Ба­хар ха­на Ло­ха­ни, на служ­бе у ко­то­ро­го по­лу­чил поч. про­зви­ще Шер-хан – Хан Тигр. По­сле по­бе­ды Ба­бу­ра при Па­ни­па­те в 1526 пе­ре­шёл на его сто­ро­ну. Сде­лал бле­стя­щую во­ен. карь­е­ру и стал на­ме­ст­ни­ком Би­ха­ра. В год смер­ти Ба­бу­ра не при­знал власть Ху­маю­на и за­хва­тил кре­пость Чу­нар, где хра­ни­лась каз­на де­лий­ских пра­ви­те­лей. Был вы­ну­ж­ден по­ки­нуть кре­пость в 1531, ко­гда её оса­дил Ху­ма­юн. В 1534–38 ук­ре­пил свою власть в Би­ха­ре и час­ти Бен­га­лии. В 1538 за­хва­тил сто­ли­цу Бен­галь­ско­го сул­та­на­та Га­ур. По­бе­див Ху­маю­на в 1539 в бит­ве при Чау­се, а в 1540 – при Ка­ланд­жа­ре, из­гнал его из Ин­дии. В 1540 про­воз­гла­сил се­бя не­за­ви­си­мым пра­ви­те­лем Сев. Ин­дии под име­нем Ш.-Ш. (Шах Тигр). Про­вёл в Сев. Ин­дии адм. и на­ло­го­вые ре­фор­мы. Про­дол­жил за­вое­ва­ния, за­хва­тив ряд кре­по­стей в Рад­жаст­ха­не, по­гиб при оса­де Ка­ланд­жа­ра. Ему на­сле­до­вал сын Джа­лал уд-дин Ис­лам Шах. Ди­на­стия Ш.-Ш. не­дол­го ос­та­ва­лась у вла­сти, в 1555 Ху­ма­юн вер­нул­ся в Сев. Ин­дию и ов­ла­дел Де­ли.

Мир в раннее Новое время

Читайте также

Подходы к таджикскому урегулированию От Ахмад Шаха к Нури

Подходы к таджикскому урегулированию От Ахмад Шаха к Нури Самолет Ту-154 вылетел с аэродрома Внуково-2 в 9 утра 30 июля 1993 года. Через 4 часа 30 минут совершили посадку в Кабуле. Это была не первая моя поездка в Афганистан. Но в качестве директора СВР прилетел в Кабул впервые. На

ИМПЕРИЯ НАДИР-ШАХА

ИМПЕРИЯ НАДИР-ШАХА Будущий покоритель Дели был в это время уже не молод. Он родился в 1688 г. в семье пастуха в Хорасане, куда афшары — одно из кызылбашских племен, не раз поднимавшее мятежи против власти, — были переселены Аббасом I из Западного Ирана. Ритм жизни северной

Глава 1 Иран Реза-шаха Пехлеви

Глава 1 Иран Реза-шаха Пехлеви У нас нет и не может быть таких целей войны как захват чужих территорий, покорение других народов, все равно идет ли речь о народах и территориях Европы, или о народах и территориях Азии, в том числе и Ирана. И. В. Сталин Служить всеми силами

Глава 21 Первые шаги нового шаха

Глава 21 Первые шаги нового шаха Вернемся в шахский дворец. Многое теперь зависело от его нового обитателя — Мохаммеда Реза. На плечи еще совсем молодого человека легла большая ответственность. С кем быть, на кого опираться как внутри страны, так и во внешней политике —

Противостояние Шейбани-хана и шаха Исмаила

Противостояние Шейбани-хана и шаха Исмаила Когда властелин Западного Туркестана, Мавераннахра, Ферганы и Хорасана, Мухаммед Шейбани-хан, сделал Узбекскую империю главной державой Центральной Азии, тогда он столкнулся с Ираном.Иран, пережив за четыре с половиной

1736–1747 Правление в Персии Надир-шаха Афшара

1736–1747 Правление в Персии Надир-шаха Афшара Надир-шах, происходивший из воинственного тюркского племени афшар, выдвинулся в 1720-х гг. в родном Хорасане как талантливый военачальник в ходе проходивших там кровавых междоусобиц. В 1726 г. в Мазендаране он с двухтысячным

ГДЕ ЖЕ ДУША ШАХА?

ГДЕ ЖЕ ДУША ШАХА? Наскоро позавтракав, мы отправились на работу. Кремнев и Леонов — к яме с колонной, я — с рюкзаком собирать керамику. Время от времени я высыпал на пол землянки кучу керамики и снова уходил в обход городища. Каждый такой поход давался труднее, потому что

* Шах Тахмасп – сын шаха Султан Хосейна.

* Шах Тахмасп – сын шаха Султан Хосейна. ____________________Поэтому, когда армянские католикосы и мелики вновь обратились к Петру Великому со своим посланием (10 ноября 1724 г.), царь соизволил принять армян под свое высокое покровительство и милостивейше повелел коменданту крепости

* Баба-ханом называли персидского Фатх Али-шаха.

* Баба-ханом называли персидского Фатх Али-шаха. ____________________Между тем, ген.-майору Несветаеву понравились мои соображения, почему и послал он троицкий полк в Карабаг, на помощь находящимся там русским войскам. Полк, приходя в Гандзак, взял с собой полковника Карягина (5) с

Серажутдин – везир шаха Пехлеви

Серажутдин – везир шаха Пехлеви В 1947 году к Правительству СССР обратился шах Ирана Мохаммед Реза Пехлеви с просьбой найти близких родственников погибшего его везира Серажутдина Гаджи-заде из Дагестана, которые по завещанию являются наследниками части его состояния.

Свержение короля Захир Шаха

Свержение короля Захир Шаха В этот период парчамисты продолжали борьбу за власть в стране. Они заключили союз со сторонниками М. Дауда. В конечном итоге 17 июля 1973 г. генерал Мухаммед Дауд[2], умело использовав офицеров-коммунистов (А. Кадыра, А. Ватанджара и С. Гулябзоя), с

Шер Шах Сури

Шер Шах Сури

В 1215 году важный для истории пуштунов (и находившийся в самом сердце их земель) город Газни был захвачен хорезмшахами. В город был направлен молодой наследник хорезмского престола, Джалал ад-Дин, с тем чтобы навести порядок в этой новой южной провинции и управлять ею. Как ранее сельджуки, сумевшие удержать город под своей властью только на два года, так и хорезмшахи удержались здесь всего на несколько быстротечных лет. А потом они были сметены бурным потоком отрядов Чингиз-хана. Джалал ад-Дин удерживал Газни не более пяти лет, но вошел в историю благодаря тому, что во многом благодаря именно ему этот жуткий бич, монголы Чингиз-хана, не проникли за Инд.

 

Отец Джалал ад-Дина, правивший в том время хорезмшах Ала ад-Дин Мухаммед II, помимо прочих успехов, сумел отнять Бухару у китайского правящего дома каракитаев, и все эти победы пробудили в нем невероятное тщеславие. Его победа над каракитаями была расценена во всем мусульманском мире как победа ислама над "неверными", что значительно повысило его авторитет. Он присвоил себе титул халифа, в документах именовал себя "Вторым Александром" (даже более чем через тысячу лет после смерти Александра его слава многим все еще не давала покоя), и даже обнаглел до того, что выгравировал на своем перстне надпись "Тень Аллаха на Земле" (а это был один из титулов сельджукских монархов).

 

Одновременно с этим, пришедший к власти в Монголии новый великий правитель, Чингиз-хан, вторгся в Китай и взял Пекин. При этом он отправил своего старшего сына Джучи управлять западной границей своих владений, где и произошли первые стычки между войсками Джучи и хорезмскими пограничными отрядами. Ислам встретился с монголами. Мухаммед, возомнивший себя лидером исламского мира, сам мечтал захватить Китай, а к вторгшимся монголам относился с нескрываемым презрением. Тем не менее, между Чингиз-ханом и Мухаммед-шахом произошел обмен посольствами, но потом, с полным пренебрежением к доброй воле и возможным последствиям, шах приказал предательски перебить посланный Чингизом караван. Монголы обиделись и в 1219 году вошли в Хорезм, разграбили и сожгли прекрасные города Бухару и Самарканд. Шах бежал на один из островов в Каспийском море, где вскоре умер. Его сын Джалал ад-Дин покинул свою вотчину Газни и решил встретиться с Чингиз-ханом лицом к лицу. На берегу Инда, неподалеку от Калабага, состоялась решающая битва, которую Джалал ад-Дин проиграл. Спасаясь от монголов, он прямо на их глазах перебрался вплавь на другой берег Инда, чем заслужил большое уважение в их глазах, потому что они в большинстве своем не только не умели плавать, но и вообще не мылись. Весьма вероятно, что именно ожесточенное сопротивление, оказанное монголам войсками Джалал ад-Дина (вкупе с его способностями пловца), заставили Чингиза думать, что Инд перейти, в принципе, можно, но лучше не нужно. Но он все-таки на всякий случай разграбил долину Инда и еще раз сжег Газни. Проход войск Чингиз-хана через район Кабула и Газни оставил эти земли в полном разорении. Газни подвергся уже второму тотальному разграблению за последние семьдесят лет, и там уже камня на камне не осталось. Со времен Мухмуда, Газни был культурным центром, который мог служить примером для жителей Пограничья. Теперь все было в прошлом – ни царя, ни двора, ни караванов, ни торговли. К счастью, сам Чингиз-хан в 1222 году ушел отсюда заниматься каким-то другими делами на просторах своей обширной державы, в спустя пять лет умер. На своем смертном одре он завещал эти новые провинции своему второму сыну Чагатаю. Возможно, он не завещал их старшему сыну Джучи не потому, что тот уже имел дело со здешними людьми и больше не хотел его иметь, и не потому, что тот отказался исполнить волю отца и пойти далеко на запад, покорять черкесов, кипчаков и русских, а потому что Джучи к тому времени рассорился с отцом, считая, что тот ведет безрассудную политику по отношению к покоренным землям и народам. К тому же, сам Джучи вскоре умер. А вся "забота" Чагатая о его новом "улусе" заключалась в том, что он в 1240 году разрушил Лахор, а через год тоже умер. Как Чагатай, так и его преемники, кажется, считали эту страну слишком бедной и слишком трудной, поэтому не очень-то старались занять ее и управлять ею. Не предпринималось никаких попыток установить монгольскую власть в этом уголке монгольской империи, если не считать переселения сюда большого числа монголов в качестве военных колонистов. Сейчас потомки этих монгольских колонистов известны как народ

хазара или хазарейцы (название происходит от персидского слова хазар – "тысяча"). Они смешались с местным населением и говорят теперь на особом языке, представляющем собой причудливую смесь фарси и монгольской архаичной лексики. Что же касается самой страны Рох, дома пуштунов, то она избежала монгольского нашествия, и нет никаких оснований считать, что пуштуны не продолжали массово устраиваться на службу в различные княжества Индии и, в принципе, жить как и раньше, не имея своего собственного государства. Вообще, со времени Чингиз-хана (1220) и до появления Тимура (1369), все исторические события, в которых участвуют афганцы, происходят в Индии, а не на их родине. За все это время, практически единственное упоминание о них не в Индии, а на их родной земле, встречается в записках марокканского путешественника Ибн Баттуты, который в 1333 году проезжал через Газни по пути в Дели. Он пишет, что по пути, на одном из перевалов, на него и его товарищей напали какие-то разбойники, которых он называет афганцами. И еще: "Мы прибыли в Кабул, некогда бывший большим городом, на месте которого сейчас расположена деревня, населённая племенем персов, называемым афганцами. В их подчинении горы и ущелья, они обладают большой силой и являются по большей части разбойниками". А про сам Газни он пишет, что этот город воина Махмуда, некогда бывший великим, теперь почти полностью разрушен. Пожалуй, монгольское нашествие дало толчок для более активной миграции пуштунов и занятия ими новых земель.

 

В 1335 году родился Тимур, который в 1369 году узурпировал власть Чагатая в Трансоксании (или Мавераннахре, области между Амударьей и Сырдарьей, на территориях современных Узбекистана, Туркменистана и Таджикистана). Он происходил из племени отуреченных монголов, жившего к югу от Самарканда, и именно Самарканд он сделал своей столицей и украсил великолепными архитектурным сооружениями, на которых начертано его имя. Он является предком Бабура и династии Моголов на Индостане. И он, и они были фактически тюрками, но считаются Чагатаями и Моголами (Монголами), так как наследовали эту части империи Чингиз-хана. Между 1379 и 1383 годами Тимур, этот наследник Чингиз-хана, захватил Герат, Систан и Кандагар. А потом он сделал то, на что не пошел даже Чингиз-хан. Он напал на афганские племена в их горах, и уже в 1398 году, когда он решил пойти завоевывать Индию, требовал от племен лоди и шерани (которые впервые упоминаются здесь под такими именами), чтобы те предоставили ему своих воинов. Вместе с этими воинами он вторгся в Индию, дошел до Хардвара на Ганге, сверг тамошнее правительство и посалил сам своего наместника. Этот наместник, а потом и его преемники, правили здесь от имени Тимуридов до 1451 года, когда на престол в Дели взошла афганская династия Лоди. И снова можно было бы надеяться, что уж теперь-то прольется свет на происходившее в то время на пуштунской Границе и появятся какие-то документальные свидетельства о событиях того времени. И снова зря, за одним исключением. Но очень интересным. Есть один документ – это фирман афганского правителя Делийского султаната из династии Лоди по имени Бахлол. В нем содержится призыв к племенам Границы идти на службу в Дели. Многие пуштуны спустились с гор в ответ на этот фирман первого правителя династии Лоди: "Лучше всего сможет править Индостаном тот, кто правит народом [, состоящим из] племен. Пусть каждый мужчина из афганских племен приведет с собой своих родственников, живущих в нужде; пусть они придут и возьмут имения в Индии, освободив себя от тяжкой доли, и поддерживая Государство [в борьбе] против могущественных врагов". Среди откликнувшихся на призыв был и некто Ибрахим из рода Сур, принадлежавшего племени Лоди. Это был дед Шер Шаха.

 

Между падением Лоди (1526) и захватом власти Шер Шахом (1539) было четыре года правления Бабура после захвата им Дели, и девять нелегких лет, в течение которых сын Бабура, Хумаюн, безуспешно пытался установить власть Моголов над пуштунской знатью и воинами. Следует понимать, что пуштуны (афганцы) в Индии относились к Бабуру и Хумаюну как всего лишь к наглым чужакам, которые пытаются влезть туда, куда их не просят. Пуштуны активно участвовали в жизни Индии уже три столетия, и треть из этого времени они правили как султаны. Захват престола Шер Шахом выглядел в их глазах как справедливая реставрация естественной и правомочной власти, а не вмешательство со стороны, как может показаться современнику. Возможно, было бы правильнее рассматривать как раз Бабура и Хумаюна как случайных узурпаторов, и подлинным началом Могольского периода считать восшествие на престол Акбара. Но до начала правления Моголов этой страной будут править Суриды – пуштунская династия. И снова нельзя не отметить этот непрекращающийся парадокс: при Бабуре (непуштуне) на жизнь пуштунов проливается свет, а при Лоди и Суридах (пуштунских царях) над северными горами снова нависают непроглядные тучи. Может, дело отчасти в том, что Бабуру, чтобы пройти по центральной Азии в Дели, нужно было "как-то договариваться" с пуштунскими племенами на их земле. А Шер Шах сам был пуштуном. И хотя его правление продлилось всего шесть лет, он остался самой прославленной фигурой в истории пуштунов, даже более великой, чем Ахмад Шах, которые двумя веками позже станет основателем царства Дурраней, несмотря на то, что он вырос за пределами страны своих предков, а может как раз благодаря этому.

 

При рождении Шер Шах получил имя Фарид. Его дед Ибрахим первым из его семьи прибыл в Индию, где начал разводить лошадей. Его отец Хасан поступил на службу к Сикандару, второму правителю из пуштунской династии Лоди, и даже получил джагир (феодальное земельное владение). А потом вырос Фарид. Легенды на скупятся на похвалы, прославляя его юные годы. Как и царь Давид, он в одиночку одолел льва (или тигра), за что получил имя Шер Хан. Именно ему отец поручил управлять семейным хозяйством, пока сам служил в султана. И юный Фарид весьма преуспел в этом деле. Есть мнение, что вся земельная налоговая система в северной Индии был построена на основе его опыта. Впрочем, в этом можно усомниться, потому что его недолгое правление было слишком насыщено борьбой за контроль над державой, чтобы у него еще оставалось время на "аграрные реформы". Но несомненно одно – Шер Шах, благодаря своей энергии и деловой хватке, сумел заточить тупую саблю своего времени и создать порядок и устройство, которые заслужили уважение, сохранившееся надолго и после его смерти. Его методы управления достаточно красноречиво описаны в речи, которую он произнес перед своими арендаторами по случаю вступления во владение своим джагиром:

 

Так как мой отец отдал в мои руки управление вашими делами, на мне лежит обязанность уделять все возможное внимание населению, способам ведения сельского хозяйства, возделыванию земель и благосостоянию арендаторов, чтобы все пребывали в тишине и спокойствии, и чтобы о моем времени говорили как о времени, когда был снят гнет с шеи слабого. Я закрою глаза на то, что было, но за то, что будет, я спрошу со всей строгостью.

 

Затем он отдельно обратился к сборщикам налогов и к земледельцам. Первым он сказал, что благополучие земли целиком зависит от крестьян, и слишком тяжелое ярмо приведет к их разорению. Он также сказал, что будет лично заезжать в каждую деревню и беседовать с сборщиками налогов и арендаторами, требуя подробного отчета о выполнении его приказов. Он также пригрозил, что если с людей будут брать слишком много, он будет наказывать вождя деревни. Впрочем, ничего не сказано о доле урожая, которая должна принадлежать непосредственно земледельцам. Возможно, это были указания "из седла", которым недоставало терпения и умения профессионального управляющего.

 

Что он точно знал, так это то, как управляться с непокорными. Он не боялся разбираться с "сильными мира сего", так сказать, с "коррупционерами", и не отдавал им никакого предпочтения перед остальными. Не дожидаясь согласия отца, и вопреки рекомендациям своих советников, он атаковал крепости тех, кто нарушал его требования:

 

Когда бунтовщики увидели его силу и умение, их охватила паника, и они начали униженно стенать. Но Фарид заметил, что это обычное дело для индусов – сначала взбунтоваться против своего правителя, и, в случае успеха, отказаться платить налоги и повиноваться; но если правитель покажет свое превосходство над ними и одолеет их, становиться малодушными и льстивыми и продолжать платить дань, но все же выискивать возможность осуществить свои планы. И, согласно своему обычаю, теперь они ползали перед ним; но ведь он с самого начала пытался образумить их словами, и всегда безуспешно, так что их подчинение было придворным.

 

Следовало заслуженное наказание, уроки усваивались, и земледельцы, чувствуя себя в безопасности и освобожденные от излишних поборов, с энтузиазмом принимались за работу. Хасан, прибыв с "инспекцией", видел, что некогда заброшенные земли возделываются и процветают.

 

Пуштунские управляющие и сегодня с восторгом упоминают принципы и методы Шер Шаха. Им особенно по душе его стремление самому побывать на месте, увидеть все своими глазами, дать четкие указания и проследить за тем, чтобы они были выполнены. Да, технологии, методы, подходы, грамотное делегирование полномочий – все это важно, но те, кто "в теме", хорошо знают, каких чудес можно добиться в Азии, если участвовать во всем и контролировать все лично. А такая привычка была второй натурой Шер Шаха. Он всегда стремился разобраться в корне вопроса, всегда был "доступен", всегда действовал решительно. Кстати, эта напористость, прямота, личная вовлеченность считается одной из важных черт "истинного пуштуна".

 

Когда Бабур прорвался к Дели, Шер Хан (тогда еще не Шер Шах) прибыл в столицу, к его двору, чтобы засвидетельствовать свое почтение и преданность. Его пригласили на ужин, на котором ему подали какое-то узбекское блюдо, которое не готовят в его краях. Шер Хан не знал, как следует его есть. Тогда он решил отбросить в сторону манеры, достал свой кинжал, порубил мясо на куски, а затем стал отправлять эти куски себе в рот большой ложкой. Бабур заметил это и сказал своему визирю, что повидал многих пуштунских вождей, пришедших к нему на службу, и у них у всех те еще манеры, но этот – самый неотесанный и дикий из всех. Бабур решил, что он может быть опасен. К счастью для Шер Хана, визирь успокоил своего господина, сказав, что пуштуны слишком ослаблены, чтобы представлять реальную угрозу для Моголов, и что нет ничего опасного в том, что этот Шер Хан не знает дворцовых манер и этикета. Бабур немного успокоился, но Шер Шах заметил, как они с визирем шептались, глядя на него, поэтому решил сразу после ужина, ни у кого не отпрашиваясь, ускакать в Сасарам, от греха подальше. Но позже он отмечал, что во время этого ужина он вполне понял манеры и привычки Могольских узурпаторов и решил, что будет нетрудно выгнать их с Индостана (в будущем). Что он и сделал примерно через десять лет, используя и мастерство, и силу, и хитрость, и решительность. Он старательно объединял всех пуштунов, недовольных новым режимом, всеми средствами привлекая их под свои знамена. Со знатью, оставшейся после падения династии Лоди, он говорил "как Лоди с Лоди", взывая к пуштунской гордости и чести, к тому, что называется у них нанг, к тому, что заставляло их прозябать в бездействии после того, как Лоди проиграли Панипатскую битву Моголам. Для потенциальных новых солдат у него была приманка в виде обещания жизни, полной приключений и богатой добычи. А из богачей он немилосердно выжимал деньги.

 

Его стратегия мобилизации заключалась в том, чтобы завоевать и сохранить преданность афганцев. Его "военной базой" была богатая провинция Бихар, которую он хорошо знал. Сначала он решил во что бы то ни стало овладеть отобрать и индусского раджи крепость Рохтас (позднее он возведет севернее неприступную крепость, которую также назовет Рохтас – видимо, название запало в душу). Сил тогда еще было маловато, поэтому он сделал это хитростью. Он усадил в паланкины самых отважны своих воинов, переодетых в женщин. Они спокойно вошли в крепость (даже не сами вошли, а их внесли), застали гарнизон врасплох, убили раджу и завладели важнейшей точкой для дальнейших действий. Затем произошло два важных сражения, после которых Хумаюну пришлось бежать из страны. Можно было бы не останавливаться на этих битвах, но во время одной из них, битвы при Чаусе, произошел случай, которых очень хорошо характеризует афганского воина.

 

Хумаюн не был трусом, но был лентяем. Когда Шер Хан напал на его войско, он принимал ванну. Когда он закончил процедуры, он собрал вокруг себя своих телохранителей и бросился в бой. Но было уже поздно и ему пришлось спасаться бегством. Он чуть было не утонул вместе со своим конем, но его спас один из его верных воинов. Больше всего он переживал из-за того, что у него уже не было никакой возможности спасти свою любимую жену, не говоря уже об остальных красавицах. А тем временем пуштуны захватили его царскую палатку, вместе со всеми наложницами и членами семьи, и вывели их к победителю. Шер Хан слез с коня, низко поклонился, и, отдав все необходимые почести, позволило им вернуться в палатку. Он приказал страже следить за тем, чтобы их никто не обижал. На следующий день их передали под попечительство некоего Хусейн Хана, "благоразумного и доброго человека, весьма в летах" (последнее обстоятельство, видимо, было немаловажным), который препроводил их в Рохтас, где их снабдили всем необходимым и отпустили. Это один из примеров поведения пуштунов по отношению к побежденным. У них никогда не было принято надругательство над женщинами или детьми поверженного врага.

 

После этих побед, Шер Хан захватил Дели, и с этого момента мы его знаем как Шер Шаха. Шер Шах начал расширять сферу своего влияния и заложил на севере новую крепость – Рохтас. Он не мог не воспользоваться случаем и не повидаться со своей родней. Тысячи пуштунов из племен Роха явились в лагерь победителя. Явились джирга (советы старейшин) из Кабула и Кандагара, и даже с берегов реки Гельманд. К одному из пришедших Шер Шах обратился на родном языке: "Подойди, О Шаикх, давай обнимемся!" Он знал о силе и притяжении языка пушту, о том, что он сближает людей одной крови и поднимает их дух.

 

Тогда же, в Хушабе, Шер Шах принял в своем лагере трех белуджских вождей из племени Хит – Исмаил Хана, Фатех Хана и Гази Хана, основателей трех Дера на правом берегу Инда, в районе, который тогда полностью принадлежал белуджам, а теперь находится в месте соединения трех пакистанских провинций – Буладжистана, Хайбер-Пахтунхвы и Пенджаба, и является культурным районом Пакистана под названием Дераджат (мн. число от дера – лагерь, поселение). Он подтвердил их права на эти владения.

 

Далее он направил свои силы против Ниязи – оседлого афганского племени, живущего на обоих берегах Инда, в районе, который теперь называется Иса Хель, в честь одного из родов Ниязи. Покорение ниязи не должно было вызвать трудностей, если учесть, что многие из этого племени уже пополнили ряды войска Шер Шаха, а Хайбат Хан, его самый верный военачальник, сам был из этого племени. Хайбат Хан был наместником Шер Шаха в Пенджабе, включая Мултан. Шер Шах поручил его опеке своего племянника, сына своего брата, рожденного от девушки-невольницы, которого звали Мубарик Хан, с тем чтобы он отвечал за территорию ниязи. Из этого примера может показаться, что факт рождения сына от невольницы не делал его автоматически бесправным у пуштунов, как это часто случалось с "бастардами" в Европе. Но не все так просто. Далее следует история, которая хорошо показывает манеры и порядки пуштунов, являясь как бы небольшим слепком с их обычаев.

 

Основными родами (кланами, хелями) племени ниязи были иса и сумбал. Так случилось, что у одного сумбальского землевладельца по имени Аллахдад была дочь, о красоте которой твердили все вокруг. "Ее ресницы – стрелы, натянутые на тетиву ее бровей, ее щеки – живое пламя, ее длинные локоны – дым от костра". Ну и все такое. Мабарик однажды увидел ее и совершенно потерял голову от любви. Напрочь забыв о родовой гордости, свойственной людям Роха, он направил к Аллахдаду тайное послание, в котором просил руки его дочери. Аллахдад засвидетельствовал свое почтение наместнику, но со всем уважением ответил, что такой знатный хан, должно быть, уже имеет в своем гареме множество знатных женщин и наложниц-рабынь. К тому же хан, воспитанный в Индии, наверняка обладает утонченным вкусом, а его бедная дочь, мол, девушка проще некуда, и годится только для людей Роха. Короче говоря, он ответил, что при всем уважении в хану о свадьбе не может быть и речи. Мубарик так огорчился, что начал нехорошо себя вести по отношению к клану сумбал, рассчитывая силой получить у Аллахдада руку его дочери. Обратите внимание, что саму ее пока вообще ни о чем не спросили. Мубарика вызвали на джиргу из трех благородных мужей. Совет (в данном случае выступающий отчасти как суд) согласился, что ранее уже были случаи заключения брачных союзов между ниязи и сурами, но это всегда были союзы равного с равным, свободнорожденного со свободнорожденным, раба с рабом, сокола с соколом, голубя с голубем. У одного из них была дочь от рабыни, и Мубарик мог взять в ее. А Аллахдад – свободнорожденный, таковая же и его дочь, и поэтому он никогда не согласится на этот союз, даже если его упрямство будет стоить ему жизни. Но Мубарик, переполненный гордостью, которую внушало ему его положение, отказался слушать их доводы и решил проучить род. Он разграбил одну из сумбальских деревень и похитил девушку-рабыню. Тогда к нему явился совет племени в полном составе и заявил, что для них честь их женщин и всех, кто находится под их опекой, значит так же много, как для Мубарика его собственная честь. Они потребовали, все еще уважительно, чтобы он отпустил девушку. Получив довольно грубый отказ, они уже прямо заявили: "Ты родился в Индии и не знаешь порядки афганцев. Никогда ранее цапля не решалась обижать сокола. Из уважения к твоему дяде, Шаху, мы относимся с уважением и к тебе, сыну рабыни. Оставь нас в покое, не притесняй нас, и отпусти девушку". "Это болтовня гордецов, - гневно ответил Мубарик, - а я меряю свою гордость изобилием в моем доме. Я оставлю девушку себе, и более того, я заберу себе дочь Аллахдада силой!" Старейшины тоже разозлились и ответили, что если ему дорога жизнь, то ему следует отвести глаза и убрать руки от их женщин, после чего Мубарик приказал своим слугам прогнать их палками. Тут уже старейшины не выдержали, и хотя он оставили оружие за пределами приемного зала (как того требовали обычаи), они с голыми руками набросились на наместника и убили его и всех его слуг… Когда об этом узнал Шер Шах, он написал Хайбат Хану, что его собственное племя сур малочисленно, и если каждый афганец убьет сура, то вообще никого не останется. И поскольку Хайбат Хан сам из племени сумбал, то пусть он с ними и разберется, и накажет их так, чтобы больше никому не приходило в голову убивать наместников.  Послание дошло не сразу, так что сумбалы успели скрыться в горах, где Хайбат не мог их достать. Поэтому, сам будучи ниязи, он пошел на хитрость. Он пообещал сумбалам, что если они придут к нему сами, под гарантию неприкосновенности, то он сможет все уладить. К нему явились девятьсот семей. Он убил всех мужчин, а женщин отправил к Шер Шаху. Император строго осудил его поступок, сказав, что никто и никогда еще на поступал так низко со своими соплеменниками. И добавил: "По крайней мере, Хайбат Хан не стремится сам заполучить корону, раз он убил так много своих соплеменников. А если бы он стремился к короне, то никогда не забыл бы свой родной пушту до такой степени, чтобы несправедливо пролить кровь своего народа". И на этом основании Шер Шах удалил Хайбат Хана из Пенджаба, но вскоре после этого, в 1545 году, Шер Шах погиб. Во врем осады форта Калинджар взорвался порох, и этим взрывом убило великого императора.

 

Шер Шах был поразительным человеком. Моголы были очень страшными врагами, в их венах текла свежая центральноазиатская кровь, которую не ослабил знойный климат их нового дома. Но Шер Шах, будучи равным им в храбрости, намного превосходил их умом и способностями. И смог вышвырнуть их из Индии. Если не считать несчастного происшествия с ниязи, он никогда не правил на Границе. Но он показал, на что способен пуштун, когда сплотил своих соотечественников, повел их в чужие земли и установил на субконтиненте порядок за какие-то пять коротких лет. Безжалостный к выскочкам, бунтовщикам и казнокрадам, он был милостив к беднякам и заботился о земледельцах. Он покрыл всю страну сетью дорог с караван-сараями. Он реконструировал "Великий колесный путь" (Grand Trunk Road или GT Road) протяженностью около 2500 километров! Он также прославился как великий строитель. Величественные ворота и зубчатые стены его Пурана-Килы ("Старой Крепости") в Дели – отражение его собственного величия. Во сравнению с нею, бастионы Лал-Килы ("Красной Крепости") Шаха Джахана, расположенные в трех милях к северу, выглядят как игрушечные, сложенные из детских
кубиков. Мечеть Шер Шаха, расположенная внутри крепости, отличается простым и благородным величием, которое бесспорно лучше сочетается с истинными идеями ислама, чем перламутровые шкатулки, построенные Моголами во славу Всевышнего.

 

 

Но еще лучше все внутреннее величие Шер Шаха раскроется перед тем, кто посетит огромный Форт Рохтас на Границе. Он раскинул свои плечи по низким каменистым холмам в нескольких милях к северу от Джелама. Его бастионы вырастают их скалы как Великая Китайская Стена; их бойницы глядят на север, на Соляной Хребет, за которым высятся снежные шапки Пир-Панджала. Как и подобает военному фортификационному сооружению, эта крепость не имеет украшений, как на царском дворце в Дели, но тесаные камни выложены искусно и пропорции радуют глаз. Периметр крепости способен вместить целое войско, и кажется немыслимым, что такой огромный монумент мощи был возведен за годы недолгого царствования Шер Шаха. Исследования говорят о том, что на строительство ушло более десяти лет, так что достраивали эту крепость уже после Шер Шаха. Но задумка принадлежала именно ему, и его дух продолжает жить в этих стенах. Качество раствора, которым соединены камни, настолько высоко, что он до сих пор надежно удерживает все конструкцию, словно символ твердой власти того, кто построил эту крепость. Не так ли разрозненные части пуштунского общества, помня о Шер Шахе, ждут прихода равновеликой ему фигуры, которая соединит их вместе как цемент? С ней они смогли бы занять то место в истории народов, которое они заслуживают.

 

  

Однажды Шер Шах сидел у крепостной стены, и вид у него был очень печальный. Придворные удивились причине его грусти, ведь он привел все дела государства в такой порядок, что для грусти не было никаких причин. Тогда Шер Шах сказал: "У меня было четыре мечты, которые я не мог осуществить, и унесу с собой в могилу. Первая: я хотел опустошить земли Роха и переселить местных жителей на равнины от Нилаба до Лахора, чтобы они пресекали попытки вторжения Моголов и прочих врагов со стороны Кабула и Индии. Такое переселение заставило бы горцев начать вести более цивилизованную жизнь. Вторая: я хотел разорить Лахор, чтобы захватчики с севера не могли войти в такой большой и богатый город и снабдить себя всем необходимым для войны. Третья: я давно мечтал построить на пути в Мекку пятьдесят надежных домов, чтобы странники, после паломничества к Святому Месту, могли отдохнуть. И четвертая: я хотел построить гробницу султана Ибрахима в Панипате, но так, чтобы напротив нее возвели другую гробницу, для султана Бабура, который сделал его мучеником. Этими деяниями я заслужил бы похвалу как от друзей, так и от врагов, и мое имя произносилось бы до самого Дня Воскресения. Но эти мечты, которые так дороги моему сердцу, я унесу с собой в могилу".

 

Конечно, он говорил на грубом языке того времени. Вторая мечта: Против Лахора у него, конечно, не было "ничего личного", просто этот город действительно не раз становился опорной точкой для завоевателей, шедших в Индию. Шер Шах говорит лишь о том, что Пенджаб – это верный путь к управлению Индией. Третья и четвертая мечта: Они говорят о том, что он был великим строителем, а также человеком религиозным и с тонкой душой. И строить он хотел не для дня текущего, а на века, во славу Божию. Первая мечта: Мечта о племенах Границы, самая поразительная. Он сумел понять силу и слабость горцев Роха. Из них он создавал свое войско, они привели его на трон в Дели. Но он слишком хорошо знал, что неорганизованные племенные общества его родной земли, раздираемые междоусобицами, с их традициями кровной мести, не смогут послужить надежным щитом и защитить его царство от будущих нападений. Наемники с легкостью уйдут от одного военачальника к другому. Он пойдут не за системой, они пойдут за человеком. Шер Шах был достаточно великим человеком, чтобы видеть, что твердость и непобедимость этих племен, их "элан", может служить государству, на территории которого они живут. Он также предсказал, что будущее пуштунов лежит в долине Инда, а не в изменчивых и аморфных княжествах центральной Азии.

 

Шер Шах похоронен в Бихаре, в Сасараме, где он вырос и впервые вкусил славы. Его гробница стоит на каменной насыпи посреди широкого водоема – это достойный памятник его величию. Но настоящие памятники Шер Шаха – Старая крепость в Дели и Форт Рохтас, глядящий через реку Джелам.

 

 

Смерть Шер Шаха, естественно, привела к борьбе за его наследство. Победил младший сын Шер Шаха, Джалал Хан, принявший титул как Салим или Ислам Шах. Старшего сына, Адил Хана, не было в столице когда умер отец, поэтому он не смог заручиться поддержкой Хайбат Хана и остальной знати, в основном ниязи. Но эти события происходили слишком далеко от Границы, от родины пуштунов. Достаточно сказать, что война между братьями и разными группами знати в конечном итоге привела к падению династии Суридов, после того как в 1554 году умер Ислам Шах. Разные претенденты стали бороться с трон Суридов, и тогда изгнанный много лет назад Хумаюн, воспользовавшись случаем, совершил реставрацию Моголов.

 

История Шер Шаха и всей династии Суридов – прекрасная иллюстрация сильных и слабых сторон пуштунского характера. Появляется лидер, достаточно великий, чтобы собрать вокруг себя людей и повести их за собой, и они забывают обо всех личных разногласиях. Но этот всего лишь "пятнадцать минут славы". Лидер умирает, и вместе с ним умирают и его замыслы. В отсутствие настоящего лидера, которому верят, за которым идут, все племенные споры и обиды снова всплывают, и все достижения теряются.

 

Так погибают замыслы с размахом,

В начале обещавшие успех,

И имя их становится забыто.

Хумаюн


XPOHOC
ВВЕДЕНИЕ В ПРОЕКТ
ФОРУМ ХРОНОСА
НОВОСТИ ХРОНОСА
БИБЛИОТЕКА ХРОНОСА
ИСТОРИЧЕСКИЕ ИСТОЧНИКИ
БИОГРАФИЧЕСКИЙ УКАЗАТЕЛЬ
ПРЕДМЕТНЫЙ УКАЗАТЕЛЬ
ГЕНЕАЛОГИЧЕСКИЕ ТАБЛИЦЫ
СТРАНЫ И ГОСУДАРСТВА
ЭТНОНИМЫ
РЕЛИГИИ МИРА
СТАТЬИ НА ИСТОРИЧЕСКИЕ ТЕМЫ
МЕТОДИКА ПРЕПОДАВАНИЯ
КАРТА САЙТА
АВТОРЫ ХРОНОСА

Родственные проекты:
РУМЯНЦЕВСКИЙ МУЗЕЙ
ДОКУМЕНТЫ XX ВЕКА
ИСТОРИЧЕСКАЯ ГЕОГРАФИЯ
ПРАВИТЕЛИ МИРА
ВОЙНА 1812 ГОДА
ПЕРВАЯ МИРОВАЯ
СЛАВЯНСТВО
ЭТНОЦИКЛОПЕДИЯ
АПСУАРА
РУССКОЕ ПОЛЕ

Хумаюн

Хумаюн (1508-1556) - правитель Могольской Индии. В 1530 году унаследовал от своего отца Бабура его индийские владения. Завоевал Малву и Гуджарат, но потерпел поражение от Шер-хана (см. Шер-шах), владетеля Бихара, при Чауса (1539) и Канаудже (1540) и бежал в Иран. С помощью собранной в Иране армии он захватил в 1545 году Кабул, а в 1555 году разбил армию одного из преемников Шер-шаха - Сикандар-шаха и овладел Дели.

Советская историческая энциклопедия. В 16 томах. — М.: Советская энциклопедия. 1973—1982. Том 15. ФЕЛЛАХИ – ЧЖАЛАЙНОР. 1974.


Что бы ни думал сам Бабур, он прожил недостаточно долго, чтобы сплотить завоеванное царство. Его здоровье было подорвано напряженной жизнью и алкоголем; не прошло и года после последней победы, как Бабур умер. Трон достался его любимому старшему сыну Хумаюну (годы правления 1530-1556), получившему в наследство огромную, недавно завоеванную, неспокойную и разобщенную империю. Не слишком надежна была и армия, состоявшая из турок, персов, афганцев и индийцев, которых удерживала вместе, казалось, только гипнотическая сила его отца.

Личность Хумаюна почти так же интересна и привлекательна, как и личность Бабура. Нежный и заботливый с близкими, обладавший отменным чувством юмора, он был в то же время храбрым воином и хорошим командиром, способным вдохновлять окружающих и стойко переносить трудности. С другой стороны, иногда он бывал капризен, потакал своим желаниям, а страсть к удовольствиям часто отнимала большую часть его природной энергии и затмевала здравый смысл. После серии блестящих военных достижений он мог остановиться и надолго предаться неге, вину, опиуму и поэзии. И пока он проводил время в беззаботной праздности, все, что было с таким трудом добыто, растаскивалось по кусочкам.

Взойдя на трон, Хумаюн вскоре показал, на что он способен. В 1531 году он легко отразил очередное нападение Махмуда Лоди, а в 1534-1535 годах провел блестящую кампанию, захватив Малву и Гуджарат. После этого он впал в характерный для него ступор и год провел в Агре, ничего не предпринимая. Неудивительно, что обе завоеванные страны были потеряны. Он равнодушно наблюдал, как на востоке растет новая опасность, как собирает силы Шер Хан, новый афганский правитель, гораздо более грозный, чем все его предшественники. Вместо того чтобы разбить его армию, Хумаюн позволил Шер Хану укрепиться в Бихаре. И только когда Шер Хан двинулся на Бенгалию, Хумаюн наконец очнулся и начал действовать. Но было, увы, уже слишком поздно.

МЕЖДУЦАРСТВИЕ, 1540-1555 ГОДЫ

В 1540 году, потерпев два сокрушительных поражения, Хумаюн был вынужден пуститься в бегство. Со все уменьшавшимся отрядом последователей он скитался от одного царя к другому с мольбой о помощи. В этих странствиях он встретил Хамиду, дочь правителя Синда. Ей было всего четырнадцать лет, и спасающийся от преследования беглец, к тому же довольно развращенный, не привлек ее внимания, так что Хумаюну пришлось потратить почти месяц, чтобы уговорить Хамиду выйти за него замуж. Это было тяжелое для Хумаюна время, когда одно разочарование сменялось другим. Хуже всего пришлось, когда его отряд пересекал пустыню в Синде. Беременная Хамида лишилась лошади, но, несмотря на ее положение, никто из спутников не согласился отдать ей коня. В конце концов Хумаюн отдал жене своего, а сам взгромоздился на спину одного из перевозивших поклажу верблюдов. Так, печально покачиваясь на спине верблюда, он проделал несколько миль, пока один из спутников наконец не выдержал этого унижения и не предложил Хумаюну свою лошадь. Там же, в пустыне Синда, 15 октября 1542 года родился будущий наследник Хумаюна Акбар, который впоследствии стал самым великим из всех Великих Моголов. Рождение сына оказалось поворотным моментом в судьбе Хумаюна — вскоре он нашел приют при дворе персидского шаха.

Тем временем Шер Хан взошел на трон, став Шер Шахом. Он укрепился в Дели, откуда управлял большей частью Северной Индии. В течение пяти лет он реорганизовал правительство и заложил основы новой административной системы. Его честолюбивой мечтой было построить что-нибудь огромное, выше и крупнее всего в Дели, такой памятник, чтобы его имя «славилось по всей земле до скончания веков». Поэтому он сильно увеличил новую цитадель, которую Хумаюн начал строить в Дели, — Пурана Килу («Старая крепость»), В соответствии со своим названием крепость сейчас — гигантский комплекс развалин, над которым возвышаются двое огромных ворот и который окружает массивная стена. Хотя от столицы Шер Шаха больше почти ничего не сохранилось, сам масштаб этой крепости заставляет воздать должное его честолюбию. Однако самым выдающимся памятником этого времени стала построенная им для себя усыпальница в Сасараме (Бихар). Этот высокий пятиэтажный мавзолей живописно расположен в центре озера; мало какой другой памятник той эпохи вызывает столь сильные романтические чувства. Проживи Шер Шах дольше, едва ли Моголам удалось бы вернуться в Индию. Но на счастье Хумаюна, в 1545 году в битве у Калинджара, одной из мощных твердынь раджпутов в Центральной Индии, Шер Шах был убит. Вскоре после его смерти созданная им империя распалась на несколько частей.

ВОЗВРАЩЕНИЕ ХУМАЮНА

Тем временем Хумаюн заручился поддержкой шаха Персии, согласившегося помочь ему вернуть свои владения. В 1545 году, в год смерти Шер Шаха, с помощью персидского войска Хумаюн отвоевал Кабул и Кандагар. Затем, после нескольких лет подготовки, он в 1554 году двинулся на Индию. Его армия, которую возглавлял полководец Байрам Хан, одержала ряд выдающихся побед, что позволило Хумаюну снова вернуть себе Агру и Дели. Власть Моголов, которая, казалось, уже пришла к бесславному концу, была восстановлена. Однако долго наслаждаться победой Хумаюну не довелось: через шесть месяцев он погиб, упав со ступеней своей библиотеки, восьмиугольного павильона Шер Мандал, который до сих пор находится внутри Пураны Килы. После беседы с астрологами на крыше павильона Хумаюн начал спускаться по ступеням и услышал призыв муэдзина к молитве. Преклоняя колени, он споткнулся и покатился вниз по лестнице. Как заметил один мало расположенный к султану хронист, «он расстался с жизнью так же, как шел по ней, — спотыкаясь».

В память о Хумаюне его вдова Хамида возвела прекрасную гробницу из белого мрамора и красного песчаника. Расположенная примерно в миле от того места, где погиб Хумаюн, она окружена прекрасными садами с прудами и фонтанами. Сама усыпальница, стоящая на платформе из красного песчаника, представляет собой восьмиугольное здание, увенчанное куполом. Ее окружает несколько меньших башен и куполов. Помимо своей красоты эта постройка представляет архитектурный интерес, поскольку здесь впервые могольские зодчие использовали свою врожденную любовь к садам и воде, чтобы подчеркнуть симметрию здания и гармонию его цветовой гаммы. Такой подход впоследствии приведет к созданию самого знаменитого памятника Моголов — Тадж-Махала.

В жизнях Хумаюна и его отца Бабура много общих черт. Когда Хумаюн умер, ему было почти сорок восемь лет, практически в том же возрасте скончался и Бабур. Для жизни обоих были характерны взлеты и падения, триумфы и несчастья, удачи и беды. Но при всем своем романтизме в жизни Бабур оставался совершенно практичным и трезвомыслящим человеком. Например, только однажды Бабур принял деловое решение под влиянием астрологов, но и то практически сразу от него отказался. Хумаюн же, напротив, мог часами пускать в воздух стрелы, на которых были на-писаны его имя и имя шаха Персии, чтобы потом потратить не меньше времени, разглядывая, как стрелы упали, и пытаться на этом основании решить, какому народу уготовано более великое будущее.

Цитируется по изд.: С. Таммита-Дельгода. Индия. История страны. М., 2007, с. 150-155.


Литература:

Prasad I., The life and time ot Humayun, Bombay, (1955).

 

 

 

ИМПЕРИЯ ВЕЛИКИХ МОГОЛОВ — информация на портале Энциклопедия Всемирная история

Го­су­дар­ст­во в средневековой Ин­дии, по­лу­чив­шее на­зва­ние от пра­вив­шей в нём ди­на­стии Ве­ли­ких Мо­го­лов.

Ос­но­ва­но быв. эми­ром Фер­га­ны и пра­ви­те­лем Ка­бу­ла Ба­бу­ром, ко­то­рый в 1526 вторг­ся в Де­лий­ский сул­та­нат, раз­бил в бит­ве при Па­ни­па­те (см. Па­ни­пат­ские бит­вы) вой­ска его пра­ви­те­ля Иб­ра­хим-ша­ха из ди­на­стии Ло­ди, за­нял Де­ли и объ­я­вил се­бя сул­та­ном. Пе­ред смер­тью Ба­бур раз­де­лил тер­ри­то­рию сво­ей дер­жа­вы, за­ни­мав­шую об­лас­ти Вост. Аф­га­ни­ста­на, Пенд­жа­ба (Панд­жа­ба) и до­ли­ны Ган­га до Бен­га­лии, ме­ж­ду сы­новь­я­ми. Соб­ст­вен­но инд. вла­де­ния унас­ле­до­вал от от­ца в 1530 Ху­ма­юн. Он за­вое­вал Мал­ву и Гуд­жа­рат, од­на­ко по­тер­пел по­ра­же­ние при Чау­са (1539) и Ка­на­уд­же (1540) от пра­ви­те­ля Би­ха­ра Шер-ша­ха из ро­да Сур и бе­жал в Иран. За­хва­тив власть, Шер-шах пред­при­нял ша­ги по ук­ре­п­ле­нию един­ст­ва гос-ва и по­зи­ций центр. вла­сти, осу­ще­ст­вил пе­ре­пись зе­мель, упо­ря­до­чил на­ло­го­об­ло­же­ние. В свя­зи с на­чав­шей­ся по­сле смер­ти Шер-ша­ха борь­бой за пре­стол в 1545 Ху­ма­юн с по­мо­щью перс. войск за­хва­тил Ка­бул, в 1555 раз­бил ар­мию од­но­го из пре­ем­ни­ков Шер-ша­ха – Си­кан­дар-ша­ха и ов­ла­дел Де­ли. Наи­боль­ше­го рас­цве­та и цен­тра­ли­за­ции М. и. дос­тиг­ла в пе­ри­од прав­ле­ния Ак­ба­ра. По­сле по­бе­ды над сво­им силь­ней­шим со­пер­ни­ком Хе­му в бит­ве при Па­ни­па­те в 1556 и ут­вер­жде­ния на пре­сто­ле Ак­бар ре­фор­ми­ро­вал сис­те­му гос. управ­ле­ния (см. Ман­саб­да­ри). Его на­ме­ст­ни­ки ста­ли по­лу­чать де­неж­ное до­воль­ст­вие из каз­ны ли­бо зе­мель­ные вла­де­ния (см. Джа­гир), на до­хо­ды с ко­то­рых бы­ли обя­за­ны со­дер­жать во­ин­ские от­ря­ды. Про­во­дил по­ли­ти­ку ве­ро­тер­пи­мо­сти, что спо­соб­ст­во­ва­ло кон­со­ли­да­ции гос-ва. Уп­ро­чил свя­зи с радж­пут­ски­ми кня­же­ст­ва­ми. При нём М. и. ох­ва­ты­ва­ла тер­ри­то­рию от Бал­ха на се­ве­ре до р. Го­да­ва­ри на юге и от Ара­вий­ско­го м. на за­па­де до Бен­галь­ско­го зал. на вос­то­ке и пред­став­ля­ла со­бой цен­тра­ли­зов. гос-во, во гла­ве ко­то­ро­го сто­ял па­ди­шах, яв­ляв­ший­ся од­но­вре­мен­но вер­хов­ным соб­ст­вен­ни­ком зем­ли. В его ру­ках бы­ла со­сре­до­то­че­на вся пол­но­та за­ко­но­дат., адм., во­ен. и су­деб­ной вла­сти. Тер­ри­то­рия М. и. бы­ла раз­де­ле­на на на­ме­ст­ни­че­ст­ва – су­бы, во гла­ве ко­то­рых стоя­ли суб­ада­ры. Гос­под­ствую­щей фор­мой зем­ле­вла­де­ния был джа­гир, ши­ро­кое рас­про­стра­не­ние по­лу­чи­ла так­же за­мин­да­ри, а так­же зем­ле­вла­де­ние му­сульм. и ин­дуи­ст­ско­го ду­хо­вен­ст­ва (вакф, со­юр­галь). Сын Ак­ба­ра Джа­хан­гир про­дол­жил за­вое­ват. по­ли­ти­ку от­ца: на­нёс по­ра­же­ние пра­ви­те­лю Ах­мад­на­гара (1616) и при­со­еди­нил к М. и. Кан­гру (1620), од­на­ко по­те­рял тер­ри­то­рии в Аф­га­ни­ста­не (в т. ч. Кан­да­гар). Прав­ле­ние Шах Джа­ха­на бы­ло от­ме­че­но ус­пе­ха­ми в борь­бе с рад­жа­ми Де­ка­на. В 1636 в со­став М. и. во­шёл Ах­мад­на­гар, в 1638 воз­вра­ще­на кре­пость Кан­да­гар. В 1646 Шах Джа­хан под­чи­нил се­бе Балх и Ба­дах­шан, од­на­ко в по­сле­дую­щие го­ды по­тер­пел ряд по­ра­же­ний от Се­фе­ви­дов и в 1647 по­те­ря­л Балх, а в 1649 – Кан­да­гар. В 1658 Шах Джа­хан был сверг­нут Ау­ран­гзе­бом, при ко­то­ром М. и. вновь на­ча­ла рас­ши­рять­ся. Для по­кры­тия во­ен. рас­хо­дов Ау­ран­гзеб уве­ли­чил на­ло­ги, во­зоб­но­вил джи­зию. Про­во­див­шая­ся им по­ли­ти­ка ре­лиг. не­тер­пи­мо­сти ста­ла при­чи­ной ря­да вос­ста­ний не­му­суль­ман­ско­го на­се­ле­ния М. и. (джа­тов в Де­ли и Аг­ре, сик­хов в Пенд­жа­бе, сек­ты сат­на­ми в Сев. Рад­жпу­та­не). Дви­же­ние ма­рат­хов во гла­ве с Ши­вад­жи, при­вед­шее к воз­ник­но­ве­нию Ма­ратх­ской кон­фе­де­ра­ции, окон­ча­тель­но по­дор­ва­ло мо­гу­ще­ст­во им­пе­рии Ве­ли­ких Мо­го­лов. В этот пе­ри­од в М. и. су­ще­ст­вен­но воз­рос­ло влия­ние Брит. Ост-Инд­ской ком­па­нии, опор­ны­ми пунк­та­ми ко­то­рой бы­ли на зап. по­бе­ре­жье в 1613–16 Су­рат, с 1668 – Бом­бей (ны­не Мум­баи), на вост. по­бе­ре­жье – с 1639 Мад­рас (ны­не Чен­наи), в Бен­га­лии – c 1690 Каль­кут­та. Во 2-й пол. 18 в. рас­пад М. и. про­дол­жил­ся. Но­ми­наль­но при­зна­вае­мые пра­ви­те­ля­ми гос-ва мо­голь­ские па­ди­ша­хи фак­ти­че­ски управ­ля­ли лишь не­боль­ши­ми тер­ри­то­рия­ми, при­ле­гав­ши­ми к Де­ли и Аг­ре. На­ря­ду с кня­же­ст­ва­ми, воз­глав­ляв­ши­ми­ся ма­ратх­ски­ми ди­на­стия­ми Бхос­ле (На­гпур), Син­дия или Шин­де (Гва­ли­яр), Хол­кар (Ин­да­ур), Га­е­к­вад (Ба­ро­да, или Ва­до­да­ра), от М. и. от­де­ли­лись Бен­га­лия, Ауд, Ро­хилк­ханд, Де­кан (кн-во Хай­да­ра­бад), на юге воз­ник­ли на­ваб­ство Ар­кат (Кар­на­тик) и кн-во Май­сур. Де­ли не­од­но­крат­но под­вер­гал­ся раз­граб­ле­нию вой­ска­ми перс. На­дир-ша­ха (1739) и афг. Ах­мад-ша­ха Дур­ра­ни (в 1748, 1750, 1752, 1757). В сер. 18 в. Брит. Ост-Инд­ская ком­па­ния на­ча­ла тер­ри­то­ри­аль­ные за­хва­ты в М. и. В 1757 под­чи­ни­ла Бен­га­лию, по ито­гам анг­ло- май­сур­ских войн к 1799 по­ко­ри­ла Май­сур, за­тем в ре­зуль­та­те анг­ло-ма­ратх­ских войн – ма­ратх­ские кня­же­ст­ва и до­би­лась от па­ди­ша­ха со­гла­сия на управ­ле­ния от его име­ни под­вла­ст­ны­ми ему тер­ри­то­рия­ми. В 1843 Брит. Ост-Индская компания ан­нек­си­ро­ва­ла Синд, в 1849 – Пенд­жаб, за­тем при­сое­ди­ни­ла кня­же­ст­ва Сам­бал­пур (1849), На­гпур и Джхан­си (1853), Хай­да­ра­бад (1853) и Ауд (1856). В 1858 в со­от­вет­ст­вии с брит. За­ко­ном о луч­шем управ­ле­нии Ин­ди­ей М. и. бы­ла уп­разд­не­на, власть полностью пе­ре­шла к брит. ко­ро­не.

© Большая Российская Энциклопедия (БРЭ)

Десятки погибших при взрыве в центре Кандагара

Подпись к фото,

В день выборов в Афганистане зафиксировано более 400 нападений

По меньшей мере 40 человек погибли и более 60 получили ранения в результате мощного взрыва в городе Кандагар на юге Афганистана.

По другим данным, произошел не один, а сразу пять взрывов.

Взрыв (или взрывы) прогремел в центре города недалеко от местного совета провинции. Здесь же размещаются несколько гостиниц и офисы неправительственных организаций.

Изначально сообщалось, что целью подрывников стал офис японской строительной компании, где главным образом работают инженеры из Пакистана.

Однако по последней информации взрывом разрушено сразу несколько зданий.

"Это было как землетрясение, - рассказал агентству Франс пресс член местного совета Ага Лалай – Отключилось электричество... Полиция оцепила район, и сейчас занимается ранеными".

"Снова они убивают детей, женщин, невинных афганцев, - заявил агентству Ассошиэйтед пресс замглавы местной полиции Мохаммед Шер Шах. – Они не люди, а животные".

Ответственность за взрыв пока не взяла ни одна из известных группировок.

Насилие после выборов

Инцидент в Кандагаре произошел вскоре после объявления первых итогов прошедших в стране президентских выборов.

Сами выборы сопровождались всплеском активности со стороны боевиков. По данным НАТО, только в день выборов в прошлый четверг было зафиксировано более 400 нападений.

Во вторник пресс-секретарь сил НАТО в Афганистане бригадный генерал Эрик Тремблэй объявил о гибели четырех американских военнослужащих. Точное место гибели американцев не сообщается, однако в заявлении было отмечено, что это произошло "во время патрулирования в одной из самый опасных частей страны".

В общей сложности базирующиеся в Афганистане иностранные силы в 2009 году потеряли уже 295 человек убитыми – больше, чем в любой другой год с начала кампании в 2001 году. За весь прошлый год потери коалиционных сил составили 294 человека.

Начиная с мая нынешнего года, США практически удвоили свое присутствие в Афганистане. В общей сложности в стране находится почти 100 тысяч иностранных военнослужащих.

Дели

Столица  Индии с 1947 года, город с богатой историей и культурой. Здесь находится огромное количество памятников, мавзолеев, храмов. Город делится на две части: Старый Дели и Новый Дели(Нью Дели) Старый Дели сохраняет памятники  эпохи  Великих Моголов 16-17 веков, здесь множество базаров, тонкие улочки, множество базаров и лавок, забитых людьми. Новый Дели был построен в  начале 20го века англичанами как столица новой империи – здесь широкие улицы, особняки в колониальном стиле, находятся посольства и правительственные учреждения.

Достопримечательности:

Ворота Индии и Раджпатх    «королевская дорога» — церемониальный проспект в центре Нью-Дели, на котором расположены мемориальные Ворота Индии, построенные в честь солдат армии Британской Индии, погибших во время афганских войн и Первой мировой войны. Имена этих солдат написаны на стенах мемориала. На стенах храма изображены поставленные на дула винтовки, перекрещенные солдатской каской. На каждой стороне храма золотой краской написаны слова Amar Jawan — «бессмертный воин» на языке хинди. Мемориал окружен зелеными лужайками, популярными местами отдыха жителей города.

Храм Лакшминараян(Бирла-Мандир )    Индуистский храм, построенный семьей Бирла в 1933-1938 году. Кроме собственно храма, название относится также к большому саду с фонтанами позади него. В храме и вокруг него в праздник Кришна-джанмаштами, или день рождения Кришны, проводится большой фестиваль.

Раштрапати-Бхаван    «Президентский дворец», построенный в смеси британского и индийского стилей, был предназначен для вице-короля Индии. Здание было открыто в 1931 году, а уже в 1950 году, с провозглашением республики, его название и назначение изменились.

Акшардхам    Крупнейший индуистский храм в мире, вошел в книгу Рекордов Гиннеса. Весь комплекс занимает площадь около 0,42 км 2, на котором расположен покрытый резьбой храм, высокотехнологичные выставки, кинотеатр-IMAX, музыкальный фонтан, площадка с ресторанами и сады. Открытие храма состоялось в 2005 году. Его строительство велось в течение 5 лет с участием 7 тысяч мастеров из Раджастхана, Ориссы и Бенгалии. Строительство обошлось в 500 млн долларов США, собранных за счёт добровольных пожертвований.

Гурдвара Бангла Сахиб    Знаменитая сикхская гурдвара (храм) в Дели, известная своей связью с восьмым сикхским гуру, Гуру Хар Кришаном, и большим прудом внутри комплекса, известным как «Саровар», воды которого считаются сикхами священными и известны как «амрита». Гурдвара была построена сикхским генералом Сардаром Бхагелем Сингхом в 1783 году, вместе с девятью другими сикхскими храмами, сооружёнными во времена правления могольского императора Шаха Алама II[1]. Миллионы сикхов прибывают в Дели со всего мира с целью посещения этого храма. Кроме сикхов, храм имеет большое значение и для многих индусов.

Гробница Хумаюна   Мавзолей могольского падишахаХумаюна в Дели, построенный по заказу его вдовы Хамиды Бану Бегум. Строительство мавзолея началось в 1562 году и закончилось 8 лет спустя. Гробница Хумаюна включена в список Всемирного наследия ЮНЕСКО.

Кутаб-Мина́р       мусульманский религиозный комплекс, расположенный в районе Южного Дели. Он был построен Кутб ад-Дин Айбаком, в 1206 году. Главный минарет, который дал название комплексу, построен из красного песчаника, и имеет высоту 72,5 м.

Он является самым высоким в мире кирпичным минаретом. Его поверхность покрыта искусной резьбой и текстами из Корана. Этот минарет был построен как символ исламского господства в Дели и в качестве главного минарета, с которого мусульман призывали на молитву. Минарет и весь комплекс имеют большое историческое значение как первый памятник, построенный исламскими правителями Индии, и как пример нового архитектурного стиля, индо-исламской архитектуры, неизвестного ранее.

Красный форт    Сооружение было первой цитаделью эпохи Моголов, задуманной в форме неправильного восьмиугольника, что стало позднее особенностью архитектурного стиля времен этой династии. Форт был заложен 16 апреля 1639 г. Шах-Джаханом, который перенёс сюда, в Шахджаханабад, столицу государства из Агры. Строительство завершилось в 1648-м, в тот же день — 16 апреля.
На территории Индии в её старых границах существуют несколько известных исторических сооружений, построенных при Великих Моголах и носящих название «Красный форт», которые иногда путают. Это, кроме Красного форта в Дели, Красный форт в Агре (по соседству с Тадж-Махалом) и Красный форт в Лахоре (ныне в Пакистане).

Джама-Масджид     Джама Масджид является главной мечетью Старого Дели. Строительство начато по распоряжению императора Великих Моголов Шаха Джахана, и завершено в 1628 году. Это самая крупная и известная мечеть Индии. Внутренняя площадь мечети вмещает до 25 000 посетителей.

Радж Гхат    Мемориал в Дели, установленный на месте кремации лидера национально-освободительного движения ИндииМахатмы Ганди.
Радж Гхат, как город, заложен в 1638 году, и является местом кремации трех, возможно, самых уважаемых в Индии людей: Махатмы Ганди (1948), Индиры Ганди (1984) и её сына Раджива (1991).
Теперь это скорее парк чем пристань. К самадхи (месту кремации) Махатмы, обозначенному невысоким черным постаментом, обращено внимание и молитвы непрекращающегося потока посетителей. Так же, по традиции, все прибывающие в страну главы иностранных государств кладут венки к этому мемориалу Отца нации.

Храм Лотоса    Это главный бахайский храмИндии и сопредельных стран, построенный в 1986 году. Огромное здание из белоснежного пентелийскогомрамора в форме распускающегося цветка лотоса — одна из наиболее популярных среди туристов достопримечательностей Дели. Известен как главный храмИндийского субконтинента и главная достопримечательность города. Храм Лотоса выигрывал несколько архитектурных наград и был упомянут во множестве газетных и журнальных статей.

Джантар-Мантар    Одна из пяти обсерваторий, построенных махараджойСавай Джай Сингхом II, задачи которой сводятся к ревизии календаря и астрономических таблиц. Обсерватория находится в Нью-Дели и состоит из 13 архитектурных астрономических приборов. Есть мемориальная доска, установленная на одну из структур обсерватории в Нью-Дели, которая была размещена там в 1910 году, где ошибочно указывалась дата строительства 1710 год. Последние исследования показали, что фактический год строительства обсерватории — 1724.

Главная цель обсерватории — составление астрономических таблиц, предсказание время и движение Солнца, Луны и планет.

Гробница Сафдарджанга     Мраморный мавзолей Сафдарджанга, премьер-министра могольского императора Мухаммад Шаха, в городе Дели, Индия. Он был построен в 1754 году в стиле могольской архитектуры. Мавзолей окружает большой сад, созданный в стиле, известном сейчас как «могольские сады» или «чарбагх». Фасад мавзолея украшен сложными узорами на штукатурке. Часть здания мавзолея сейчас занимает Археологическое управление Индии.

Сады Лоди   Городской парк в Дели, Индия. Парк  содержит гробницу Мухаммада Шаха, Сикандера Лоди, Шиш Гумбад и Бара Гумбад, примеры архитектуры 15 века, когда в Дели господствовали пуштунские династии Саййид и Лоди. Сейчас парк находится под охраной археологического надзора Индии (ASI). Сады расположены между рынком Кхан и Гробницей Сафдарджанга на Дороге Лоди. Парк является популярным местом отдыха жителей Дели.

Пурана-Кила   Крепость 16 века на территории Национальной столичной территории Дели, один из Семи исторических городов Дели. Крепость была построена как цитадель города Динапанах, заложена могольским императором Хумаюном в 1533 году и завершенная пятью годами позже. Однако в 1540 году Хумаюна разбил Шер-шах Сури, который переименовал город и крепость в Шергарх и значительно расширил её. Но Шер Шах погиб в 1545 году, и Империя Сури продержалась еще только 10 лет. В результате Хумаюн вернул себе форт в 1555 году, но и сам умер в следующем году.
Сейчас крепость открыта для посетителей, ежедневно после захода солнца здесь проводятся постановки, на которых рассказывают об истории Дели.

Церковь Святого Иакова   Английская церковь в Дели, построенная в 1836 году полковником Джеймсом Скиннером, одна из старейших церквей города и часть Делийской епархии. Церковь расположена у Кашмирских ворот. Она служила кафедральным собором вице-королевства до сооружения Кафедральной церкви Спасения в 1931 году. Во дворе церкви похоронены Джеймс Скиннер, британский наместник Дели Уильям Фрейзер и служащий Ост-Индской компании Томас Меткалф.

Национальный музей в Нью-Дели      Крупнейший музей в Индии, содержащий коллекцию разнообразных археологических находок, исторических артефактов и предметов искусства. Музей управляется Министерством культуры Индии, частью Правительства Индии. Он находится на пересечении улиц Джанпат и Маулала.

Парламент Индии (Сансад)    Высший федеральный орган законодательной власти в Индии. Включает в свою структуру Президента Индии и две палаты: нижнюю палату, называемую Лок сабха, и верхнюю палату, именуемую Раджья сабха. Резиденция парламента расположена в Нью-Дели и носит название Сансад Бхаван. Законодательные акты принимаются путём утверждения законопроекта обеими палатами и последующего одобрения его Президентом. Центральный зал заседаний парламента традиционно используется для совместных заседаний нижней и верхней палат.

Гробница Сафдарджанга   Мраморный мавзолей Сафдарджанга, премьер-министра могольского императора Мухаммед Шаха в городе Дели. Мавзолей построен в 1754 году и охарактеризован как "последний яркий блеск могольской архитектуры". Мавзолей окружен большим “Могольским садом”, его фасад украшен гипсовым резным орнаментом.

 

Познакомьтесь с командой стоматологов Feather Touch

Наши стоматологи

Наша команда в Feather Touch Dental Care в Мидтауне Атланты стремится предоставить стоматологическую помощь высочайшего качества, ориентированную на пациента. Мы тесно сотрудничаем с нашими пациентами, чтобы разработать индивидуальные планы лечения высочайшего качества, которые создают здоровую и красивую улыбку.

Когда вы выйдете из нашей практики, вы будете удивлены тем, насколько расслабленно вы себя чувствуете. Вся наша команда сосредоточена на предоставлении необходимых услуг в одном удобном и комфортном месте.

Наша команда


Наша стоматологическая бригада состоит из трех гигиенистов, четырех помощников и двух специалистов по административной поддержке. Вместе мы работаем с командой косметической стоматологии доктора Росса, доктора Нила Шаха и доктора Дэвида Кима, чтобы обеспечить жителей Атланты удобной и немедленной стоматологической помощью. Вся наша команда хорошо обучена и имеет большой опыт, и мы постоянно совершенствуем свои навыки и знания, чтобы предоставить вам лучший сервис.

Мы всегда гордимся своей способностью слушать.Если у вас есть опасения, мы всегда выслушаем то, что вы скажете. Мы особенно хорошие слушатели, если вы нервничаете и чувствуете, что что-то еще может помочь вам чувствовать себя комфортнее.


Дональд Х. Росс, DMD


Дональд Росс, выросший в Атланте, штат Джорджия, в молодости интересовался стоматологией. После учебы в Технологическом университете Джорджии и Университета Эмори, где он получил степень бакалавра химии, доктор Росс поступил в стоматологическую школу Университета Алабамы. Как только он получил свой DDS, Dr.Росс поступил на службу в ВВС США, где два года проработал стоматологом. Когда его выписали, он открыл офис на площади Колони.

Более 20 лет доктор Росс обслуживает стоматологию общего профиля и косметическую стоматологию в этом районе. Он следит за последними исследованиями и информацией по стоматологии и посещает курсы повышения квалификации. Доктор Росс принадлежит к множеству организаций, включая Американскую стоматологическую ассоциацию, Стоматологическую ассоциацию Джорджии, Стоматологическую ассоциацию Северного округа и Стоматологическое общество Хинмана.Он также является членом многочисленных местных и национальных учебных клубов, в том числе Стоматологического учебного клуба Peachtree и Партнерской программы Georgia Tech Dental Technology.

Доктор Росс официально уволился из Feather Touch Dental Care с февраля 2018 года, но всегда будет основным продуктом нашей растущей практики.


Нил Шах, DMD


Доктор Нил Шах присоединился к Feather Touch Dental в феврале 2011 года. Он родился в Далласе, штат Техас, в возрасте шести лет переехал в Атланту.Он учился в Технологическом институте Джорджии, получив степень бакалавра наук. Кандидат технических наук с отличием. Оттуда он пошел прямо в Медицинский колледж Джорджии, получив докторскую степень. Доктор Шах провел более 2000 часов в непрерывном обучении и скоро получит степень магистра Академии общей стоматологии в 2019 году, честь, ограниченная избранными стоматологами, которые посвящают свое время совершенствованию своего образования. Он страстно желает помочь людям добиться улыбки своей мечты и поддерживать оптимальную устную помощь.Он является активным членом семи различных стоматологических организаций и четырех учебных клубов по всей Атланте. Доктор Шах также является официальным дантистом команды Atlanta Hawks.

Доктор Шах женат на Теджале Какаде, который также работает дантистом в Кэрроллтоне, штат Джорджия. Они живут в Смирне со своими двумя собаками. В августе 2017 года доктор Шах и Теджал представили своего нового дополнения, своего сына Наяна Шаха. В свободное время он с удовольствием проводит время со своей семьей и друзьями, смотрит фильмы, занимается кикбоксингом и пытается играть в гольф.

Я стоматолог МАГД! Что это значит для вас и вашей семьи?

MAGD - это магистр Академии общей стоматологии. Получение степени магистра означает приверженность непрерывному стоматологическому образованию (CE) после окончания учебы. Менее 2 процентов стоматологов общего профиля в США и Канаде имеют степень магистра AGD. Когда вы посещаете стоматолога с именем MAGD после его имени, вы можете быть уверены, что ему небезразличны новейшие методы и лучшие практики в стоматологии. Мастера AGD практикуют эти методы в классе несколько раз в год - не каждый стоматолог делает это.

Менее

2% стоматологов общего профиля сделали это, и ваш - один! *

Я заработал свой MAGD

Чтобы стать мастером AGD, стоматолог должен:

  • Завершить более 1100 кредитных часов CE.
  • Заработайте 400 из этих 1100 кредитов на практических курсах.
  • Сдать экзамен, равный по сложности сертификационным экзаменам совета директоров.


Дэвид Т. Ким, DMD, FICOI


Доктор Дэвид Ким - уроженец Джорджии, который очень рад стать частью стоматологической команды Feather Touch.Он вырос в округе Гвиннетт и учился в Университете Джорджии (Go Dawgs!), Который окончил со степенью бакалавра микробиологии. Затем он заработал свой D.M.D. в Медицинском колледже Джорджии (переименованном в «Стоматологический колледж Джорджии при Университете Огасты»).

После окончания стоматологической школы д-р Ким решил и дальше совершенствовать свои клинические навыки и был принят в ординатуру общей практики / повышения квалификации Медицинского колледжа Джорджии. Эта резиденция предоставила докторуКим с обширным образованием в области хирургической и имплантологической стоматологии, И.В. седация, удаление зуба мудрости и ведение сложных с медицинской точки зрения пациентов.

Доктор Ким является активным членом Стоматологической ассоциации Джорджии, Американской стоматологической ассоциации, Академии общей стоматологии и членом Международного конгресса оральных имплантологов (ICOI). Он также добровольно работает в качестве клинического инструктора в Стоматологическом колледже Джорджии. Продолжая расширять свои знания и навыки в области стоматологии, он помогает в обучении резидентов имплантологии и оказании комплексной стоматологической помощи пациентам.

Доктор Ким живет в Мидтауне, Атланта, со своей невестой Николь. В свободное время он любит путешествовать, посещать спортивные мероприятия и проводить время с друзьями, семьей и своей будущей женой.


Лора


Я работаю стоматологом-гигиенистом почти восемь лет. Я поступил в колледж Клейтона и Государственный университет в Морроу, штат Джорджия, где получил степень бакалавра в области стоматологической гигиены. Мне выпала большая честь провести всю свою гигиеническую карьеру в лучшем стоматологическом кабинете Атланты.В Feather Touch Dental у меня есть время, чтобы сосредоточиться как на обучении моих пациентов, так и на заботе об их гигиенических потребностях. Потратив время на то, чтобы рассказать им об их здоровье полости рта, я также могу помочь им улучшить здоровье всего тела.


Бриттани Уилсон


Бриттани Уилсон - один из новейших членов команды Feather Touch Dental Care. Она выросла в небольшом городке Монтичелло, штат Джорджия. После получения степени по гигиене полости рта в Афинском техническом колледже она практиковала во многих офисах по всей Джорджии.Ее опыт работы в качестве дипломированного стоматолога-гигиениста был действительно положительным. В начале 2015 года ей посчастливилось отправиться в свою первую стоматологическую поездку в Гондурас. Ей нравится путешествовать, читать и проводить время с семьей и друзьями. Бриттани гордится тем, что является членом очень заботливой и опытной команды Feather Touch Dental Care.


Маргарита Джонсон


Маргарита Джонсон присоединилась к команде Feather Touch в 2018 году в качестве координатора по стоматологической гигиене.Она родилась и выросла в Чикаго, а в 2017 году переехала в Атланту. В стоматологии она работает с 2008 года. За это время она поставила перед собой задачу помочь пациентам сохранить здоровье полости рта посредством профилактики и раннего обнаружения. Она увлечена здравоохранением и считает, что отличное здоровье полости рта способствует здоровому системному здоровью, потому что это главные ворота в наш организм. У Маргариты и ее мужа 4 сына до 4 лет. В свободное время она любит путешествовать, водить своих детей и собаку в парк и пробовать новые блюда по всему городу.


Шеркондра Фицджеральд


Шеркондра Фицджеральд - наш координатор по расписанию. Она родилась и выросла в Атланте, штат Джорджия. Она работает в стоматологической сфере с 2011 года и сильно увлечена уходом за пациентами. В свободное время она любит читать, работать в саду, путешествовать и проводить время со своей семьей. Она также любит учиться и пробовать что-то новое, например, есть экзотические блюда и путешествовать по экзотическим местам. У нее есть 11-летний Ши-Цзы, которого она обожает.Она чувствует себя поистине счастливой быть частью Feather Touch Dental, поскольку мы обеспечиваем нашим пациентам высочайший уровень обслуживания.


Лиза Боумен


Лиза Боуман - одна из наших новейших ассистентов стоматолога. Лиза родом из Лексингтона, штат Кентукки, где она получила стипендию на полное обучение в Университете штата Кентукки и получила степень бакалавра наук. в образовании. Позже она переехала в Теннесси, где стала зарегистрированным ассистентом стоматолога. За 30 лет работы в стоматологии она работала в различных областях стоматологии - от реставрации до имплантатов.В свободное время Лиза любит путешествовать, посещать различные спортивные мероприятия и проводить время с семьей. Она мать двоих детей и бабушка 5 детей.


Зои Клвана


Зои Клвана родилась и выросла в небольшом городке Шерман, штат Коннектикут. Она получила степень бакалавра наук в области стоматологической гигиены в Университете Западной Вирджинии. Поехали, альпинисты! Перед переездом в Атланту она несколько лет практиковалась в округе Вестчестер, штат Нью-Йорк. Зоя заботится о благополучии каждого из своих пациентов и уделяет особое внимание качеству их лечения.Ей нравится знакомить своих пациентов с информацией, необходимой им для поддержания чистоты и здоровья ротовой полости и общего здорового образа жизни. Зое посчастливилось побывать в двух стоматологических поездках с миссией, где она оказывала бесплатную стоматологическую помощь малообеспеченным общинам в Гондурасе и Белизе. В свободное время Зои проводит время со своей семьей, друзьями и парнем. Ей нравится путешествовать, ходить в походы и кататься на лыжах!


Катя Гревас


Катя - ассистент стоматолога расширенного профиля с более чем двадцатилетним опытом работы.Она получила начальное стоматологическое образование в Германии и продолжала идти в ногу с растущей сферой деятельности в Соединенных Штатах, посещая курсы повышения квалификации в Университете Кентукки, а также значительную подготовку в области зубных имплантатов и седации.
Ее внимание к клиентам непревзойденно, а комфорт пациента - ее главный приоритет.
Катя переехала в Атланту несколько лет назад и любит проводить время с мужем и тремя детьми, исследуя город и путешествуя.


Шер Шерман


Шер получила диплом продвинутого и базового стоматолога в Институте карьеры Concorde в Денвере, штат Колорадо.Шер родом из Санкт-Петербурга, Флорида, но живет в Грузии более восьми лет. Она энергичный и увлеченный ассистент стоматолога и важный член команды Feather Touch Dental.
Шер здесь, чтобы сделать ваш визит к стоматологу максимально комфортным и легким. Ее теплый характер и яркая улыбка всегда помогают пациентам чувствовать себя непринужденно.
Когда Шер не работает, она любит проводить время с семьей, заниматься спортом и оставаться в форме.


Записаться на консультацию косметолога

Наша команда в Feather Touch Dental Care в Атланте, штат Джорджия, предлагает последние инновации и современные методы лечения, которые помогут вам добиться уверенной и здоровой улыбки в расслабляющей обстановке, напоминающей спа.Наши услуги косметической стоматологии устраняют незначительные эстетические проблемы и устраняют сильные повреждения, чтобы выявить красивую внутреннюю улыбку.

Запишитесь на консультацию по косметической стоматологии с доктором Нилом Н. Шахом и доктором Дэвидом Т. Кимом онлайн или по телефону 404-892-2097, чтобы получить высококачественную косметическую стоматологическую помощь в Атланте. Наша стоматологическая бригада тесно сотрудничает с пациентами, чтобы найти приемы, которые подходят для их активного образа жизни.


Связанные с этим

Перед приездом: выучите местный язык

Планируете поездку в Луизиану? Вот небольшой ускоренный курс в некоторых уникальных для Луизианы условиях, чтобы, как опытный путешественник, вы могли сливаться с местными жителями.С чего лучше начать, чем с одного из любимых развлечений Луизианы: еды.

Когда вы заказываете po’boy , вы заказываете Луизианский эквивалент подводной лодки или сэндвича с героем. Человек за прилавком спросит вас, хотите ли вы, чтобы он был заправлен (с майонезом, салатом и помидорами), и если po’boy приходит с чипсами или картофелем фри, это lagniappe или что-то еще. Это должно помочь вам, , хорошо провести время, (или оживить его) во время еды и испытать то, что луизианцы называют joie de vivre (радость жизни).Но будьте осторожны, потому что веселье, как говорят, заправляет gumbo ya ya , или все говорят сразу.

Если вы пойдете в любой ресторан Cajun или Creole в штате, вы, вероятно, увидите в меню слово gumbo . Этот густой суп почти всегда включает в себя три ингредиента луизианской кулинарии trinity - сельдерей, болгарский перец и лук, но еще более важный ингредиент гамбо - это roux , смесь подрумяненного масла и муки, используемая для приготовления гамбо. Аналогично произносится, но по-другому пишется: rue , по-французски «улица», которую вы увидите на знаках по всей южной Луизиане.(В Новом Орлеане вы иногда увидите calle , что также означает «улица» по-испански. Причина этой языковой смеси заключается в том, что до образования штата Луизиана была французской колонией, затем испанской, а затем французской. снова колония.)

Если говорить о колониальной эпохе, то на улицах Нового Орлеана нет срединных участков - это нейтральных территорий . Термин происходит от нейтральной полосы земли на улице Канал (названной в честь запланированного канала, который так и не был построен), которая отделяла франко-креолов, живущих во Французском квартале ( vieux carre или «старая площадь») от англоязычных новоприбывших который жил в районе, который сейчас известен как Центральный деловой район.Кроме того, вместо тротуаров на улицах часто устраивают банкеты.

Еще одна важная вещь, на которую следует обратить внимание, это то, что жители Нового Орлеана не имеют понятия о севере, юге, востоке или западе. В Big Easy находятся верхний город , центр города , берег реки или берег озера . Местные направления зависят от географического положения города между озером Пончартрейн и рекой Миссисипи и направления, в котором река течет по отношению к городу (например, если бы вы плыли на бревне вниз по реке Миссисипи через Новый Орлеан, вы бы прошли по мере того, как вы продолжаете движение к центру города).Но, как показывает опыт, Лейксайд находится на севере, Риверсайд - на юге, Аптаун - на западе, а Даунтаун - на востоке. Отметим, что западный берег , который на самом деле южный, относится к пригородам через реку. Совет инсайдера: приобретите карту или приложение. А если местный спросит, «Где ты?» они на самом деле не хотят знать, где вы находитесь, а спрашивают: «Как дела?»

Продолжая географическое примечание, Луизиана - единственный американский штат, у которого есть приходов, вместо округов.Это из-за того, что в колониальный период и раннюю государственность здесь проживало преимущественно католическое население - районы с ранним правительством почти отражали церковные приходы. Когда Луизиана стала штатом в 1812 году, это был первый штат, в котором люди, не говорящие по-английски, составляли большинство населения. Неудивительно, что у нас уличные указатели на иностранных языках!

Во время вашего визита вы, вероятно, также захотите совершить поездку по нашим болотам и болотам. Обычно вы получаете доступ к этим областям через проливов , а не через ручьи или ручьи.Если вы хотите самостоятельно покататься на небольшой лодке, просите не каноэ или каяк, а пирогу . А если взять с собой удочку, то можно поймать sac-au-lait (не буквально мешок с молоком, а белого окуня или краппи).

После дня, проведенного на воде, вы захотите надеть танцевальную обувь, чтобы приготовиться к fais-do-do (fais-DOUGH-DOUGH), каджунской вечеринке с музыкой, танцами и едой. И если кто-то назовет вас cher (SHAH), они не имеют в виду поп-диву 70-х - они используют термин нежность.

Мы надеемся, что эти примеры помогут вам в следующем приключении в Луизиане. Обязательно попробуйте их, пока вы laissez les bons temps rouler (пусть хорошие времена катятся).

Роль CheB и CheR в комплексном хемотаксическом и аэротаксическом пути Azospirillum brasilense

Конструирование мутантов.

Все стандартные этапы клонирования выполняли, как описано ранее (25). Космиду pFAJ451 переваривали AviII и EcoRI для высвобождения фрагмента, содержащего гены cheB и cheR , который затем клонировали в сайты SmaI и EcoRI pUC18, в результате чего получали pUCBR.pUCBR трансформировали в компетентных клеток E. coli, JM110. Для создания мутанта cheB , вырезанная SmaI кассета gusA-km из pWM6 (21) была клонирована в сайты BclI с репарированными по концам фрагментами Кленова SmaI и T4 pUCBR, давая pGA1. pGA1 полностью переваривали EcoRI и частично BamHI, репарировали конец (End-it repair kit; Epicenter, Madison, WI) и клонировали в pCR-Blunt (Invitrogen, Carlsbad, CA), получая pGA2. EcoRI-расщепленный pGA2 клонировали в тот же сайт pSUP202, что привело к pGA3.Компетентные клетки E. coli S17-1 трансформировали pGA3 и использовали в качестве донора при спаривании с двумя родителями с A. brasilense (35). Рекомбинанты подвергали скринингу на предмет двойной гомологичной рекомбинации и вставки кассеты в рамку считывания путем посева реплик и тестирования активности GusA (21). Один такой рекомбинант, GA3, был дополнительно охарактеризован как мутант cheB (таблица).

Для создания мутанта с инсерцией-делецией cheBR фрагмент EcoRI / BamHI был выделен из pUCBR и клонирован в те же сайты pBluescript II SK (+), что привело к pBSKBR.Полярную кассету канамицина вырезали из pHP45Ω путем расщепления HindIII, ремонтировали концы и клонировали тупым способом в SmaI и сайты EheI с репарированными концами pBSKBR, получая pBS101. Реставрированный по концам EcoRI и NotI-фрагмент из pBS101, содержащий конструкцию Δ cheBR :: Km r , клонировали в pCR-Blunt (Invitrogen), что давало pBS102. ПЦР с pBS102 в качестве матрицы и праймерами CheBR-F (5'-CCGGAATTCGCAAGATGAGCGGCGGGGACA) и CheBR-R (5'-CGGAATTCGCGGAAGGAGGCCATCTGGCG) использовали для амплификации конструкции Δ cheBR : EcoRI (сконструированные сайты рестрикции, подчеркнуты) и клонировали в расщепленную EcoRI pSUP202 (26), получая pBS103.Клетки E. coli EC100 (Epicenter) трансформировали pBS103, которую затем переносили в A. brasilense путем трехгодичного скрещивания с использованием pRK2013 в качестве помощника (10), как описано ранее (12). Скрининг на двойную гомологичную рекомбинацию проводили, как описано выше. Саузерн-гибридизацию использовали для проверки потери плазмиды. Один такой мутант cheBR (BS104) был дополнительно охарактеризован (таблица).

Для конструирования мутанта cheR внутренний фрагмент cheR амплифицировали с помощью ПЦР с праймерами CheR-F1 (5'-CGACATCACGGAGGCG) и CheR-R1 (5'-CACTTGTCGCCCTGCTG) и клонировали в pCR2.1 TOPO (Invitrogen), в результате чего была получена pBS107. pBS107 переваривали EcoRI и клонировали в сайт EcoRI плазмиды pKNOCK-Gm (3), которая не реплицируется в A. brasilense , в результате чего получали pBS108. E. coli EC100D pir- 116 клеток трансформировали pBS108 и вводили в A. brasilense путем трехродственного скрещивания. Однократная гомологичная рекомбинация привела к образованию гена cheR , прерванного вставкой вектора pKNOCK-Gm (мутант cheR , BS109) (таблица).Поскольку cheR является последним геном оперона хемотаксиса (12), никаких полярных эффектов не ожидалось.

Мутант оперона хемотаксиса был сконструирован путем вставки полярной кассеты в cheA , первый ген оперона (12), тем самым разрушив весь оперон. Во-первых, фрагмент, содержащий полный ген cheA и 545 п.н. последовательности ДНК перед опероном хемотаксиса, был амплифицирован из pFAJ451 с использованием праймеров cheAop-HindF (CCCAAGCTTCAGCGCGATGAACTGGTTGGACT) и cheAY-XhoR (GGGCTGTC) с последующим перевариванием Сайты XhoI (сконструированные сайты рестрикции, подчеркнуты) и клонированы в те же сайты pBluescript II SK (+), давая pGA111.Стратегия на основе обратной ПЦР (38) с использованием праймеров CheA-Del-F (5'-GAAGATCTGCGGTCGCGCGGGAATTC) и CheA-Del-R (5'-GAAGATCTGACCGCGTCCGCCGCACG) (сконструированные сайты BglII подчеркнуты) и pGA111 в качестве шаблона, сгенерированного линейной продукт с сайтами BglII на обоих концах подлежащего удалению внутреннего фрагмента длиной 555 п.н., который был точно удален путем расщепления с последующим самолигированием. Конструкция pGA112 была проверена секвенированием. Расщепление BglII и NcoI с последующей репарацией концов рестрикционных сайтов удалило дополнительный внутренний фрагмент длиной 1975 п.н.Расщепленная SmaI кассета gusA-km из pWM6 (21) была вставлена ​​в удаленную область, давая pGA113. Конструкция cheA Δ :: gusA-km была высвобождена из pGA113 путем переваривания XhoI, затупилась путем репарации концов и расщепления SmaI и клонирована в pCR-Blunt (Invitrogen, Carlsbad, CA), давая pGA114. Расщепление EcoRI pGA114 высвободило cheA Δ :: gusA-km для клонирования в расщепленную EcoRI pSUP202 с получением pGA115. pGA115 вводили в A.brasilense от трех родителей с использованием pRK2013 в качестве помощника. Были отобраны единичные гомологичные рекомбинанты, несущие делецию-вставку в cheA и вставленную плазмиду pSUP202. Гибридизацию по Саузерну и ПЦР использовали для проверки вставки рекомбинантной плазмиды. Один такой мутант che (BS110) был дополнительно охарактеризован (таблица).

Все окончательные конструкции были проверены секвенированием (DNA Core Facility, Университет Теннесси) перед переносом в A.brasilense для конъюгации и конструирования мутантов.

Поведенческие анализы.

Клетки A. brasilense плавают за счет вращения одного двунаправленного полярного жгутика (42). Изменение направления плавания (реверсирование) вызывается коротким движением назад вдоль оси клетки из-за переключения направления вращения жгутиков в сочетании с уменьшением скорости плавания, что случайным образом переориентирует клетки в новом направлении (42 , 43). Клетки выращивали в MMAB с добавлением выбранного источника углерода (10 мМ) до ранней экспоненциальной фазы, наблюдали с помощью темнопольного микроскопа и записывали на видео.Частота реверсирования измерялась путем определения количества реверсий отдельной ячейки в течение 5-секундного временного кадра, что соответствует среднему времени, в течение которого отдельная ячейка может быть отслежена. Увеличение времени отслеживания не повлияло на результаты. В каждом эксперименте измеряли частоту обращения не менее 90 клеток (из трех независимых культур). Частота обращения клеток, отмытых в буфере для хемотаксиса (10 мМ фосфатный буфер [pH 7,0], 1 мМ EDTA) перед анализом, была аналогична описанной выше.

Чашки с мягким агаром (так называемые «роевые чашки») и анализы временного градиента на хемотаксис и аэротаксис выполняли, как описано ранее (1, 2, 42, 43). Временную реакцию на аттрактанты измеряли после выращивания клеток в MMAB до ранней экспоненциальной фазы, трехкратной промывки клеток и их ресуспендирования в буфере для хемотаксиса. Чтобы оценить время отклика на удаление аттрактанта, клетки смешивали с аттрактантом для тестирования до конечной концентрации 10 мМ.Затем клетки стимулировали добавлением буфера для хемотаксиса для уменьшения концентрации аттрактанта с 10 мМ до 2,5 мМ, вызывая репеллентный ответ. Было измерено время, необходимое примерно для 50% населения, чтобы вернуться к предвзятости подвижности до стимула. Анализ временного градиента для аэротаксиса проводился с микрокамерой, вентилируемой газами кислорода и азота в установке, разработанной Ласло и Тейлором (18) и адаптированной для A. brasilense (43). Анализ пространственного градиента для аэротаксиса выполняли, как описано ранее (43), помещая подвижные клетки в оптически плоский капилляр (внутренние размеры 0,01 мкм).1 на 2 на 50 мм; Vitro Dynamics, Inc., Рокавей, штат Нью-Джерси). Используемые клетки промывали и ресуспендировали в буфере для хемотаксиса с добавлением 10 мМ малата.

Анализ в непрерывном потоке.

Анализы в непрерывном потоке были выполнены, как описано ранее для стимуляции химическими веществами для E. coli (15) и кислородом для Halobacterium salinarum (19), с некоторыми модификациями. Клетки выращивали до поздней экспоненциальной фазы в MMAB с добавлением 5 мМ малата и 5 мМ фруктозы.Клетки промывали буфером для хемотаксиса с хлорамфениколом (100 мкг мл -1 ), инкубировали с 50 мкКи l- [ метил - 3 H] метионин (Amersham Biosciences) с хлорамфениколом (100 мкг мл -1 ). в течение 2 ч и помещали на стерильный встроенный фильтр (Acrodisc, 0,45 мкм; Pall Gelman), подключенный к перистальтическому насосу. Фильтр промывали при скорости потока 3 мл / мин в течение 35 мин буфером для хемотаксиса, 10 мин - аттрактантом (10 мМ) в буфере для хемотаксиса и 5 мин - буфером для хемотаксиса.Фракции собирали каждые 30 с. Аликвоту (100 мкл) из каждой фракции помещали в микроцентрифужную пробирку в сцинтилляционной жидкости (Beckman Ready Solv-HP) и подвергали парофазному переносу в течение 48 часов. Образцы подсчитывали в течение 10 мин с помощью сцинтилляционного счетчика (LS 6500; Beckman Instruments). Для высвобождения метанола при аэротаксисе N 2 или O 2 (21%) барботировали через буфер для хемотаксиса или аттрактант и промывали фильтрующий узел, как описано ранее (19).

Шер - Биография, рост и история жизни

Шер Образование

Школа: Подготовительная школа колледжа Монклер
Средняя школа Фресно

Галерея Шер

Для этого слайд-шоу требуется JavaScript.

Шер Карьера

Профессия: Певица, актриса, телеведущая

Известен по: Cher

Заработная плата: На рассмотрении

Собственный капитал: Около 360 миллионов долларов США

Семья и родственники

Отец: Джон Саркисян

Мать: Джорджия Холт

Брат (и): Нет

Сестра (и): Георганн Лапьер

Семейное положение: В разводе

Муж / парень: Рон Циммерман (2010)

Детский: 2

Сын (и): Чаз Боно, Элайджа Блю Аллман

Дочь (и): Нет

Бывшие парни:

Эрик Клэптон

Сынок (1964-1975)

Уоррен Битти (1962)

Дэвид Геффен (1973–1974)

Элвис Пресли (1974)

Грегг Оллман (1974-1979)

Джин Симмонс (1978-1980)

Les Dudek (1980-1982)

Рон Дугай (1982)

Вал Килмер (1982–1984)

Джошуа Донен (1984-1986)

Том Круз

Роб Камиллетти (1986-1989)

Томми Ли (1988)

Ричи Самбора (1989)

Тим Медвец (2008-2010; 2012-2013)

Рон Циммерман (2010)

Cher Избранное

Хобби: Пение, актерское мастерство, еда

Любимый актер: Кевин Аукойн

Любимая актриса: Кэтрин Хепберн

Любимое направление: Лондон

Любимый цвет: Коричневый, Темно-красный

Американская певица Шер является поклонницей Имрана Кхана, но пакистанцы могут дать ей небольшой совет

- Реклама -

Американская поп-певица Шер только что поделилась, что является большой поклонницей Имрана Кхана со времен его игры в крикет.

Мировая музыкальная сенсация, которая проводила кампанию за Kaavan’s (одинокого обитателя слона Маргазарского зоопарка) Freedom отправилась в Твиттер, чтобы поблагодарить Имрана Хана за его помощь.

Шер была полна радости с тех пор, как Высокий суд Исламабада (IHC) приказал переместить Кааван в приют для животных. Недавно в серии твитов она поблагодарила каждого человека, который внес свой вклад в этот процесс.

Шер также упомянула Имрана Кхана в своем твите и оценила его доброту.

«Я был большим поклонником тебя, когда ты играл в крикет Имран Хан. Я всегда думал, что ты такой добрый », - написала певица.

Я был большим твоим поклонником, когда ты играл в крикет @ImranKhanPTI. Я всегда думал, что ты такой добрый. Спасибо большое за вашу помощь. Это сбывшаяся мечта‼ ️ @ftwglobal #kaavan

- Шер (@cher) 1 июня 2020 г.

Однако пакистанцы поспешили поделиться маленьким советом для Шер!
Это b
, потому что многие поклонники Имрана Кхана остались разочарованы с тех пор, как его политическая семья PTI пришла к власти.

Сестренка, вот как он нас заполучил, не поддавайтесь на это!

- shmilo (@shmyla) 1 июня 2020 г.

- Реклама -

Также читайте: американская певица Шер благодарит пакистанское правительство. За согласие освободить одинокого слона Кааван

Некоторые даже задавались вопросом, какую роль Имран Хан играл во всем процессе.

Освободить Каавана приказал не Имран Хан. Это был судья Атар Миналлах из Высокого суда Исламабада.Возможно, Имран Хан даже не знал о Кааване с самого начала.

- Хайдер Имтиаз (@mhaiderimtiaz) 1 июня 2020 г.

Я думаю, вы путаете его с судьей Имраном Ханом из Высокого суда Исламабада…. Ой, подождите, это не он судья, который вынес это решение. Имран Хану наплевать на старого слона, если он не начнет гадить на доллары. Простите @cher….

- AD (@AdeelShk) 2 июня 2020 г.
Что ж, из-за всей дискуссии о блокировке и отсутствии блокировки кажется, что Cher - единственный, кто хвалит PM rn.

- Реклама -

«sMothered»: Шер Хабшер однажды снялась в «My Super Sweet 16»

Ни в коем случае! Моя Super Sweet 16 квасцы Шер Хабшер сильно изменилась с тех пор, как она была избалованным подростком. В наши дни звезда реалити-шоу демонстрирует свою семейную сторону на TLC sMothered .

Шер была в хит-шоу с первого сезона. sMothered , который сейчас идет во втором сезоне, следует за четырьмя группами матерей и дочерей и подчеркивает их чрезвычайно тесную связь, некоторые даже сказали бы слишком близкую.

«Люди знали, кем я был, когда мне было 16 лет, но многое изменилось», - сказал в 2019 году в интервью газете New York Post . «Я рад поделиться взрослым со всем миром».

Прокрутите ниже, чтобы узнать последние подробности о звезде реалити-шоу!

Кто такая Шер Хабшер?

Поклонники впервые были представлены уроженке Флориды в ее эпизоде ​​ My Super Sweet 16 . У нее была вечеринка на тему Марди Гра, где ее несли на поплавке.Затем она исполнила убийственный танец для всех своих друзей и семьи.

В наши дни 30-летний мужчина ведет более сдержанный образ жизни, но всегда любит повод для празднования. В 2016 году она подумала о 10-летнем юбилее своего роскошного вечера.

Кто мама Шер?

Доун Хабшер - заботливая мать Шер. В сериале Доун рассказала, что они лучшие друзья со дня ее рождения. Дуэт матери и дочери почти все делает вместе. Шер описывает их как «близнецов», и в апреле они выпустили книгу об их уникальных отношениях под названием A Bond That Lasts Forever .

Предоставлено Шер Хабшер / Instagram

Кто муж Шер?

Шер познакомилась со своим мужем, , доктором Джаредом Гопманом, , когда они оба учились в Университете Флориды. «Мы познакомились на первом курсе и были влюбленными в колледж, мы обручились в конце колледжа, а через год поженились», - объяснила Шер в интервью Post . Пара поженилась в 2013 году и с тех пор переехала в Нью-Йорк, где проходила резидентуру Джареда по пластической хирургии.

Они приветствовали свою первую дочь Белль в июле 2019 года.В мае красавица радовалась празднованию юбилея дуэта. «7 лет спустя. Навсегда идти! » она написала в Instagram смайликом с красным сердцем.

Предоставлено Шер Хабшер / Instagram

Чем занимается Шер?

После окончания школы Шер стала болельщицей хоккейной команды Tampa Bay Lightning. Хотя она все еще время от времени балуется реалити-шоу, в основном она работает медсестрой и тренером по свиданиям.

«Я начала работать медсестрой в психиатрической больнице и четыре года проработала во Флориде», - сказала она New York Post.«И я увидела, что многие депрессии и беспокойство возникают из-за плохих привычек в отношениях. Поэтому, когда я переехал в Нью-Йорк, я получил сертификат коучинга по жизни и открыл свой собственный бизнес коучинга на свиданиях под названием NYC Wing Woman, и я помогаю мужчинам и женщинам научиться ориентироваться в сфере свиданий в Нью-Йорке. Это очень удивительный и полезный опыт ».

Шер приедет в Пакистан, чтобы встретиться с «самым одиноким слоном в мире», когда его наконец переселят

Шер собирается посетить Пакистан в эти выходные, чтобы отпраздновать отъезд Каавана, которого называют «самым одиноким слоном в мире», который скоро покинет зоопарк ради лучшие условия после многих лет лоббирования правозащитными группами и активистами.

Расписание Шер не было обнародовано из соображений безопасности, но «она уже в пути», - сказал Мартин Бауэр из Four Paws International, венской группы защиты животных, которая возглавила сборную по спасению Каавана.

Слон томился в зоопарке Пакистана более 35 лет, а в 2012 году потерял своего партнера. Ранее в этом году ветеринары диагностировали у него избыточный вес и недоедание, а также он страдает поведенческими проблемами. В воскресенье он собирается отправиться в убежище в Камбодже.

Шер взялся за дело Каавана и громко отстаивал его переселение, битва за которое началась в 2016 году. Компания Four Paws, которая часто выполняет миссии по спасению животных, оказала необходимую медицинскую помощь, прежде чем Кааван сможет путешествовать.

«Благодаря Шер, а также местным пакистанским активистам судьба Каавана попала в заголовки газет по всему миру, и это способствовало облегчению его передачи», - сказал Бауэр в пятницу.

По словам Бауэра, даже после того, как он окажется в Камбодже, ему потребуются годы физической и даже психологической помощи.

Из-за ужасных условий жизни, в которых виновата системная халатность, высокий суд Пакистана в мае постановил закрыть зоопарк Маргазар в столице Исламабада, где Кааван прожил большую часть своей жизни.

В то время Шер описала это решение как «один из величайших моментов в моей жизни».

Медицинское обследование в сентябре показало, что ногти Каавана были потрескавшимися и заросшими - результатом многих лет проживания в неподходящем вольере с полом, повредившим его ноги.

Слон также развил стереотипное поведение, часами качая головой из стороны в сторону, что медицинская бригада ветеринаров и экспертов обвинила в его полной скуке.

В течение последних трех месяцев команда «Четыре лапы», включая ветеринара доктора Амила Халила и Управление дикой природы Исламабада, готовила Каавана к отъезду. Члены благотворительной группы также будут сопровождать его в святилище.

Бауэр высоко оценил мощное влияние голосов знаменитостей на права животных.

«Знаменитости, которые высказываются за добрые дела, всегда приветствуются, так как они помогают начать публичный дискурс и усиливают давление на ответственные органы», - сказал он.

«Во всем мире есть любители животных, известные и малоизвестные, и поддержка каждого из них имеет решающее значение», - добавил он.